Pruebas PCR: El kit de caldo para paellas que nos enfermó a todos


Nunca había sido tan urgente y trascendente buscar y ofrecer la verdad. Y es que nunca había estado toda la humanidad tan cerca del precipicio.

La Tragipandemia, esa locura colectiva que mantiene aterrorizada a casi toda la población mundial por lo menos en el primer mundo, está derivando poco a poco en una terrible dictadura que a poco que no movamos un dedo nos traerá definitivamente su tan querido Nuevo Orden Mundial.

Estamos ante un reset económico y social sin precedentes en la historia y la gente sigue confiando ciegamente en sus captores, en los secuestradores de su libertad, en sus verdugos. Siguen obedeciendo ciegamente a las autoridades sanitarias y políticas y tragándose todos los cuentos para niños que nos escupe la televisión.

Gráfico trucado de forma patética por RTVE para ofrecer la ilusión óptica de que una caída del PIB del 2,6% es similar a una del 18,5%
Parece que no utilizan mucho las matemáticas cartesianas para elaborar sus gráficos y cualquier numero es igual en tamaño.

Y todo gracias a un supuesto virus, el SarsCov2 y al test que supuestamente sirve para detectarlo, el test PCR o reacción en cadena de la polimerasa (Polymerase Chain Reaction).

El test PCR, la máquina de falsificación covidiana, el Paellus Caldus Recipe, el horror que la #ciencia_que_calla no explica de manera comprensible, ese gran invento científico que su descubridor Kary Mullis,  dijo que no valía para realizar diagnóstico médico y que sin embargo es utilizado a nivel mundial para vendernos los casos de la enfermedad Covid19.

Hoy les contaremos que a parte de no servir para nada ya que no detecta en sí ningún virus sino sólo pequeños trozos de ADN, esos tests PCR son un negocio brutal para los laboratorios.

Las farmacéuticas no son precisamente hermanitas de la caridad y los test junto con las vacunas son casi más rentables que los medicamentos ya que estas compañías apenas pierden las demandas judiciales en ninguno de los dos casos. Luego veremos como advierten los fabricantes de las limitaciones de sus test para no pillarse los dedos.

Cada test en USA vale 230$ para 1000 reacciones, o sea podemos realizar un test a 25 personas a ciclos de 40 reacciones. Lo que arroja la no despreciable cifra de 3700 millones de dólares en una población como la de Estados Unidos.

Todo es un negocio en el Covid19 como hemos podido ver con el tema de las mascarillas. Ya que como la gente las utilizaba una y otra vez tuvieron que mostrarnos que son el perfecto criadero de bacterias y hongos y por tanto se deberían de cambiar y desinfectar más a menudo. En vez de reconocer que no existe ni un solo paper científico actual que pruebe que este supuesto virus SarsCov2 se transmite por el aire y que una mascarilla es por tanto necesaria y efectiva para su no transmisión. No, no existe ni un solo paper científico que haya motivado que un pais como España haya impuesto esta dictadura del bozal.

Esta semana pasada trataba de explicarle a una enfermera jubilada que trabajó en quirófano más de 30 años lo que es la prueba PCR y porque su propio inventor reconoció que no servía para verificar carga viral y por tanto no servía para hacer diagnósticos clínicos. Lógicamente al hablarle de Kary Mullis se puso a la defensiva como toda persona adoctrinada por grandes medios de manipulación de masas como el periódico el País, ya que este tipo de prensa manipulada y manipuladora aprovechó de manera torticera la muerte de este premio Nobel para defecar un artículo titulado “Muere Kary Mullis, el Nobel que negaba la existencia del virus del sida y del cambio climático”.

El señor Mullis aprovecho cada momento que le dio la vida para contar la verdad y para buscarla. En ese artículo podemos leer textualmente:

“El mismo diario estadounidense afirmó en 1998 que Mullis era “posiblemente la persona más extraña que jamás haya ganado un Nobel de Química”. En 1994, sólo un año después de obtener el premio, el investigador visitó España para dar la charla de clausura del congreso de la Sociedad Europea de Investigación Clínica, en Toledo, pero se negó a hablar de su gran descubrimiento. En su lugar, decidió divulgar su teoría de que el sida no está provocado por un virus, sino que surge por la exposición a muchos otros agentes patógenos. Mullis, un genio en su campo, demostró que un Nobel puede ser un auténtico irresponsable fuera de su disciplina.”

Comparen lo que el propio Mullis contaba en su libro sobre su conferencia en Toledo con lo que el periódico el País escupe en sus páginas…invitas a un Nobel pero solo si cuenta lo que tu quieres que cuente.

Les invito a escuchar a Kary Mullis a partir del minuto 12 en un fragmento del documental francés publicado en la cadena ARTE “Sida- La duda. Desinformación y ocultación de los medios”, una maravilla que tenía solo 6000 visualizaciones en los 8 años que llevaba colgado en Youtube.

Como se que desaparecerá les dejo una copia por aqui.

Si Kary Mullis estuviese con vida no podrían haber utilizado su invento para entre comillas “inventarse” esta Tragipandemia. No los hubiera dejado. Sus palabras les atronarían y perseguirían por todas las redes sociales que aunque controladas también por el poder aun nos permiten cierta sensación de libertad.

Se preguntarán vds porque no oímos que otros científicos se quejen amargamente de que gracias a este tipo de pruebas moleculares rápidas podemos meter la pata hasta el corvejón que decía mi abuela. Y se quejan, como la Catedrática de análisis clínicos ya jubilada de la universidad de Murcia María José Martínez pero sus lamentos no llegan a los platós de televisión.

Por ejemplo leía esta semana pasada un hilo del doctor Thomas Binder @Thomas_Binder médico cardiólogo e internista que escribió su tesis sobre inmunologia y virologia en 1984 y que cuenta con 32 años de experiencia tratando pacientes. Decía así:

En 2007, el New York Times explicó muy bien cómo una prueba PCR sin sentido científico había creado una epidemia falsa de tos ferina en 2006. ¿Nos explicarán algún día que en 2020 la pandemia de corona falsa se creó exactamente de la misma manera?

El desastre Coronavirus en pocas palabras:

Una prueba inespecífica no validada se usa de forma incorrecta para identificar a los afectados por un virus en particular y, lo que es peor, para designar a los que han muerto a causa de ese virus.

Para ser precisos: son las pruebas sin sentido las que crean un desastre increíble. Es la fe de muchos en una prueba sin sentido pseudocientífica.

Creer en la ciencia es creer, no ciencia.

¡La prueba es la enfermedad, no el virus!

Durante toda mi vida nunca hemos analizado con un test ningun virus del resfriado, excepto cuando se necesitaba una terapia específica.

Luego vino el aprendiz de brujo Christian Drosten director del instituto de virología hospital de la caridad en Berlín con su prueba de la nada y puso todo al revés.

¡Aquí se va a armar la gorda!”

Este doctor se refería a la pseudo epidemia causada en un hospital donde casi a 1,000 trabajadores de la salud en el hospital de Lebanon en New Hampshire se les realizó una prueba preliminar PCR y se les suspendió el trabajo hasta que obtuvieron sus resultados; A 142 personas, incluido el Dr. Herndon que levantó la liebre sobre un supuesto brote de tosferina, se les dijo que parecían tener la enfermedad; 1,445 trabajadores de la salud terminaron tomando antibióticos y 4,524 trabajadores de la salud en el hospital, o el 72 por ciento de todos los trabajadores de la salud allí, fueron inmunizados contra la tos ferina en cuestión de días. Las camas de los hospitales implicados en este supuesto brote fueron retiradas del uso habitual, incluidas algunas en cuidados intensivos. Y todo por realizar pruebas PCR a todo el que tosiera o pasará por allí. ¿Les suena de algo esto?

En el artículo del New York Times podemos leer textualmente:

Decir que el episodio fue disruptivo fue un eufemismo, dijo la Dra. Elizabeth Talbot, epidemióloga estatal adjunta del Departamento de Salud y Servicios Humanos de New Hampshire.

“No te puedes imaginar”, dijo el Dr. Talbot. “Tuve la sensación en ese momento de que esto nos dio una sombra de lo que podría ser durante una epidemia de gripe pandémica“.

Sin embargo, dicen los epidemiólogos, uno de los aspectos más preocupantes de la pseudo epidemia es que todas las decisiones parecían muy sensatas en ese momento.

La Dra. Katrina Kretsinger, epidemióloga médica de los Centros federales para el Control y la Prevención de Enfermedades, que trabajó en el caso junto con su colega, la Dra. Manisha Patel, no culpa a los médicos de Dartmouth.

“El problema no fue que reaccionaron de forma exagerada o hicieron algo inapropiado”, dijo la Dra. Kretsinger. En cambio, es que a menudo no hay forma de decidir temprano si una epidemia está en curso.

La Dra. Cathy A. Petti, especialista en enfermedades infecciosas de la Universidad de Utah, dijo que la historia tenía una lección clara.

El gran mensaje es que cada laboratorio es vulnerable a tener falsos positivos“, dijo el Dr. Petti. “Ningún resultado de prueba es absoluto y eso es aún más importante con un resultado de prueba basado en PCR

Yo elabore un hilo en marzo de este año mostrando cómo unos científicos chinos habían publicado un paper sobre la alta tasa de falsos positivos titulado “Tasa potencial de falsos positivos entre las ‘personas infectadas asintomáticas’ en contactos cercanos de pacientes con COVID-19

Dicho texto fue fulminado por el gobierno chino apenas haber sido publicado el 5 de marzo de 2020 en varias publicaciones científicas incluida pubmed.

Hoy podemos encontrarlo como retirado por decisión del consejo editorial por las presiones supuestamente sufridas por los lectores.

Parece que no hay cabida para la ciencia disidente y mucho menos en China. El texto desde luego no podia ser más claro…

Sin embargo aqui estamos, en medio de la mayor operación psicológica de inducción al miedo a través de una supuesta epidemia creada en base a los resultados que arroja una prueba, la PCR, que tiene más sombras que luces.

 

Gracias a esta herramienta han logrado que el miedo “al bicho” permanezca en el inconsciente colectivo prolongando algo que no existe…ni hay pandemia de SarsCov2 ni mucho menos existen enfermos asintomáticos, solo existen los rebrotes porque lo dice el test PCR, el kit de caldo para paellas para crear la tragipandemia.

Los medios de comunicación de masas en una connivencia sin fisuras han conseguido inocular el miedo en una población alienada…24 horas de bombardeo continuo de mentiras, embustes y medias verdades.

Nuestros telediarios le tendieron la alfombra roja a las muertes por Covid-19. Con o por…esa era la cuestión.

Y miedo. Mucho miedo. El miedo en los medios. Medios para infundir miedo.

Estamos inmersos en la segunda ola según los medios, afortunadamente los fallecidos hay que buscarlos con lupa.

Exactamente en la misma proporción que se han realizado más pruebas PCR así ha crecido el numero de contagiados.

 

La misma curva…a más test PCR más infectados.

Si analizamos los datos que nos proporciona Nuestro mundo en datos punto org estamos ante una discoteca con luces intermitentes por todos lados…no me deja incrustar el mapa pero pueden verlo aqui.

 

Nuestra amiga, médico, Yane escribió un artículo llamado “Las mentiras diagnósticas del Coronavirus” donde ya en julio mostraba al emperador desnudo pero parece que los políticos, los medios y los rebrotes por realizar PCR iban a empezar a pasearse entre multitudes y nos culparían a los sanos, esta vez los mas jóvenes tendrían la culpa.

Asi que vamos a explicar en que consiste esta prueba PCR con la que han conseguido volver a inocular el miedo sin que hayan apenas fallecidos por este supuesto virus.

¿Cómo funciona la PCR?

Primero la explicación científica reducida que podemos leer en un estupendo articulo publicado en burbuja.info por entcons

Dejaremos en la descripción del podcast como siempre todos los enlaces para que podáis ampliar la información. Este post de burbuja se llama “Manual para dummies ¿por qué el test PCR no sirve en absoluto para detectar el Covid?” y fue publicado ya en abril de este año 2020. Dice así:

Vamos a culturizar un poco al personal. Trataré de simplificar al máximo.

El test PCR funciona de la siguiente manera:

1) tienes una serie de secuencias de oligonucleótidos que puedes comprar en el mercado y en teoría son específicas del 2019-Covid.

Éstas curiosamente cambian dependiendo del país, o sea cada país impone sus secuencias oficiales para detectar 2019-Covid.

Lo que tienen en común para todos los países es que lógicamente esas las secuencias deben existir en el genoma aislado del 2019-Covid .

2) Veamos aquí cuáles son la secuencias oficiales para detectar 2019-Covid en Europa:

Aquí nos muestra 9 secuencias con entre 15 y 20 nucleótidos o letras genicas.

Research Use Only 2019-Novel Coronavirus (2019-nCoV) Real-time RT-PCR Primer and Probe Information

3) Esas secuencias son lo que se llaman “primer forwards” ,”primer reverse” y “probe”. Volveremos a esto más adelante.

4) Al realizar la prueba, se coge una muestra de la traquea de la persona y se mete en un tubo de ensayo. En esa muestra se encuentran multitud de de organismos con DNA .

5) Se procede a calentarlo a 90 grados para que el DNA se divida en dos cadenas en el termociclador.

6) El “forward primer” comprado en el mercado se junta automáticamente al inicio de la cadena, y el “primer reverse” al final de la cadena, pero eso sólo ocurre sí y sólo sí el DNA de la muestra es el del 2019-Covid, en caso contrario los pares no se acoplarían. El acoplado de cada par de cada secuencia es binario, es decir cada par sólo puede acoplarse su complementario.

7) En el proceso se acopla también el “Probe” en mitad de la cadena, con una molécula de fosforecencia.

8) Se inicia el proceso de polimerización en tiempo real, por el que la enzima polimerasa empieza a rellenar los huecos existentes generando nuevo DNA sintético (en verde en gráfico de arriba), hasta que la cadena original de muestra del paciente queda totalmente acoplada con su otra contraparte (compuesta del forward primer, reverse primer, y nuevo DNA proveniente de la polimerización).

9) Así conseguimos un DNA perfecto de 2 cadenas y la liberación de la molécula fosforecente.

10) Se repite el proceso hasta en 40 ciclos (que incluyen calentamiento y enfriamento) que van generando más y más fosforecencia en cuanto más y más sea la cantidad de coincidencias entre los “primers” “forwards” y “probes” (en teoría específicos del 2019-Covid) con el ADN de la muestra del paciente. Eso significará teóricamente que a más intensidad de fosforecencia, para un máximo 40-45 ciclos, más carga viral de Covid debería tener el paciente.

Aquí se explica más detalladamente el proceso entero:
How COVID-19 is diagnosed: bacterium assisted DNA searching – Articles

¿Cuáles son los problemas del test PCR para detectar el Covid?

1- No hay un estándard mundial y cada país usa las secuencias que desea.

2- A mayor nivel de ciclos de temperatura, más positivos, dado que hay más probabilidad ruido y contaminación, y por lo tanto menos fiabilidad.

3- Y en mi opinión el más grave: la polimerización rellena todos los huecos que dejan los primers y probes. Eso quiere decir que si los primers y probes no encajan al 100% en todos sus pares con la cadena de la muestra, la polimerización rellenará esos huecos y, a base de ciclos, dará falsos positivos.

Pero… ¿es que los primers y probes no son específicos del 2019-nCovid? Es como si pregunto si 4 frases al azar sólo pueden existir en un libro. Pues no, pueden aparecer estadísticamente en cualquier otro en una biblioteca de trillones de libros (orden de magnitud del genoma de un virus).

Vosotros mismos podéis comprobar esas secuencias oficiales del 2019-Covid en la base de datos BLAST para el genoma humano:

Probad de hacer vosotros la misma búsqueda en BLAST para las otras secuencias en teoría específicas del 2019-Covid y os daréis cuenta que aparecen todas en el genoma del Homo Sapiens con porcentajes de coincidencia del 70 al 90%.

TCTGGTTACTGCCAGTTGAATCTG

GGGAGCCTTGAATACACCAAAA

¿Qué quiero decir con todo esto?

1) Que el test PCR para detectar el 2019-Covid puede dar los falsos positivos que queramos simplemente aumentando el número de ciclos o comprando en el mercado los primers (gran negocio para los laboratorios vendiendo cosas que nadie mira con microscopio electrónico) que nos dé la gana como hace cada país

2) Que cuando das positivo, lo único que quiere decir con 100% de probabilidad es que eres un Homo Sapiens. No es posible discernir el positivo Homo Sapiens del positivo 2019-Covid. Si das negativo es porque entras dentro del ruido estadístico.

Se liberan más moléculas de colorante fosforescente con cada ciclo de PCR. Esto conduce a un aumento en la señal de fluorescencia proporcional a la cantidad de ampliación sintetizado.

“More dye molecules are released with each PCR cycle. This leads to an increase in the fluorescence signal proportional to the amount of amplicon synthesized. “

3) Los propios test PCR directamente comprados en China pueden estar infectados con 2019-Covid. Así que vigilad qué os meten en la boca para extraer la muestra. (Y ojo porque los propios test del CDC también han sido probados como contaminados, luego leeremos una noticia sobre ello)

Cada país fija su procedimiento para el test PCR seleccionando primers y probes, procedimiento extracción , conservación, número de ciclos. Así pues un país podría fijar un número de ciclos fijo que acabará fijando siempre el mismo porcentaje de positivos y negativos simplemente por ruido estadístico (por ejemplo, cada 100 testeados salen siempre 10 positivos).

Pues resulta que en el Coronavirus Update (Live): 2,014,554 Cases and 127,598 Deaths from COVID-19 Virus Pandemic – Worldometer no te dicen la cifra de testeados, sólo la cifra de positivos (activos y cerrados). ¿Sabéis por qué? Para que no se vea que siempre es el mismo porcentaje de positivos respecto testeados para cada país! Cosa que indicaría que el test no sirve para nada ya que los resultados se fijan de antemano con el procedimiento. El número de positivos simplemente depende de la cantidad de testeados, procedimiento de cada país.

Esta sería la explicación científica…no se si os habéis dado cuenta de que al romper la cadena de ADN y volver a recomponerla con la enzima Polimerasa creamos el doble de cadenas de ADN que teníamos…o sea entramos en una progresión geométrica. La máquina de hacer ADN de la que hablaba el creador de la técnica Kary Mullis.

Esto me recordó a la leyenda del tablero de ajedrez y los granos de trigo.

Cuenta la leyenda que hace mucho tiempo reinaba en cierta parte de la India un rey llamado Sheram.

En una de las batallas en las que participó su ejército perdió a su hijo, y eso le dejó profundamente consternado. Nada de lo que le ofrecían sus súbditos lograba alegrarle.

Un buen día un tal Sissa se presentó en su corte y pidió audiencia. El rey la aceptó y Sissa le presentó un juego que, aseguró, conseguiría divertirle y alegrarle de nuevo: el ajedrez.

Después de explicarle las reglas y entregarle un tablero con sus piezas el rey comenzó a jugar y se sintió maravillado: jugó y jugó y su pena desapareció en gran parte. Sissa lo había conseguido. Sheram, agradecido por tan preciado regalo, le dijo a Sissa que como recompensa pidiera lo que deseara.

– Sissa, quiero recompensarte dignamente por el ingenioso juego que has inventado —dijo el rey.

El sabio contestó con una inclinación.

– Soy bastante rico como para poder cumplir tu deseo más elevado —continuó diciendo el rey—. Di la recompensa que te satisfaga y la recibirás.

Sissa continuó callado.

– No seas tímido —le animó el rey—. Expresa tu deseo. No escatimaré nada para satisfacerlo.

– Grande es tu magnanimidad, soberano. Pero concédeme un corto plazo para meditar la respuesta. Mañana, tras maduras reflexiones, te comunicaré mi petición.

Cuando al día siguiente Sissa se presentó de nuevo ante el trono, dejó maravillado al rey con su petición, sin precedente por su modestia.

– Soberano —dijo Sissa—, manda que me entreguen un grano de trigo por la primera casilla del tablero del ajedrez.

– ¿Un simple grano de trigo? —contestó admirado el rey.

– Sí, soberano. Por la segunda casilla, ordena que me den dos granos; por la tercera, 4; por la cuarta, 8; por la quinta, 16; por la sexta, 32…

– Basta —le interrumpió irritado el rey—. Recibirás el trigo correspondiente a las 64 casillas del tablero de acuerdo con tu deseo: por cada casilla doble cantidad que por la precedente.

Pero has de saber que tu petición es indigna de mi generosidad. Al pedirme tan mísera recompensa, menosprecias, irreverente, mi benevolencia. En verdad que, como sabio que eres, deberías haber dado mayor prueba de respeto ante la bondad de tu soberano. Retírate. Mis servidores te sacarán un saco con el trigo que solicitas.

Sissa sonrió, abandonó la sala y quedó esperando a la puerta del palacio.

Durante la comida, el rey se acordó del inventor del ajedrez y envió a que se enteraran de si habían ya entregado al irreflexivo Sissa su mezquina recompensa.

– Soberano, están cumpliendo tu orden —fue la respuesta—. Los matemáticos de la corte calculan el número de granos que le corresponde.

El rey frunció el ceño. No estaba acostumbrado a que tardaran tanto en cumplir sus órdenes.

Por la noche, al retirarse a descansar, el rey preguntó de nuevo cuánto tiempo hacía que Sissa había abandonado el palacio con su saco de trigo.

– Soberano —le contestaron—, tus matemáticos trabajan sin descanso y esperan terminar los cálculos al amanecer.

– ¿Por qué va tan despacio este asunto? —gritó iracundo el rey—. Que mañana, antes de que me despierte, hayan entregado a Sissa hasta el último grano de trigo. No acostumbro a dar dos veces una misma orden.

Por la mañana comunicaron al rey que el matemático mayor de la corte solicitaba audiencia para presentarle un informe muy importante.

El rey mandó que le hicieran entrar.

– Antes de comenzar tu informe —le dijo Sheram—, quiero saber si se ha entregado por fin a Sissa la mísera recompensa que ha solicitado.

– Precisamente por eso me he atrevido a presentarme tan temprano —contestó el anciano—. Hemos calculado escrupulosamente la cantidad total de granos que desea recibir Sissa. Resulta una cifra tan enorme…

– Sea cual fuere su magnitud —le interrumpió con altivez el rey— mis graneros no empobrecerán. He prometido darle esa recompensa, y por lo tanto, hay que entregársela.

– Soberano, no depende de tu voluntad el cumplir semejante deseo. En todos tus graneros no existe la cantidad de trigo que exige Sissa. Tampoco existe en los graneros de todo el reino. Hasta los graneros del mundo entero son insuficientes. Si deseas entregar sin falta la recompensa prometida, ordena que todos los reinos de la Tierra se conviertan en labrantíos, manda desecar los mares y océanos, ordena fundir el hielo y la nieve que cubren los lejanos desiertos del Norte. Que todo el espacio sea totalmente sembrado de trigo, y ordena que toda la cosecha obtenida en estos campos sea entregada a Sissa. Sólo entonces recibirá su recompensa.

El rey escuchaba lleno de asombro las palabras del anciano sabio.

– Dime cuál es esa cifra tan monstruosa —dijo reflexionando.

– ¡Oh, soberano! Dieciocho trillones cuatrocientos cuarenta y seis mil setecientos cuarenta y cuatro billones setenta y tres mil setecientos nueve millones quinientos cincuenta y un mil seiscientos quince.

La ciencia actual nos trata a todos como verdaderos gilipollas, como ignorantes que no merecen saber nada de esas maravillas científicas y por eso evitan utilizar un lenguaje medianamente inteligible…por eso nosotros vamos a traducirlo para niños.

Por desgracia ya no tenemos con nosotros a Kary Mullis que habría evitado que se utilizase su técnica para crear esta tragipandemia.

“Los científicos están haciendo un daño terrible al mundo en nombre de ayudarlo. No me importa atacar mi propia fraternidad porque me da vergüenza”.

Mullis luego se hizo eco de una de las afirmaciones más controvertidas de Duesberg.

“Los seres humanos están llenos de retrovirus”,”No sabemos si son cientos o miles o cientos de miles. Hace poco comenzamos a buscarlos. Pero nunca han matado a nadie antes. La gente siempre ha sobrevivido a los retrovirus”.

Mullis desafió la sabiduría popular de que los mecanismos del VIH que causan enfermedades son simplemente demasiado “misteriosos” para comprenderlos. “El misterio de ese maldito virus”, dijo en ese momento, “ha sido generado por los $ 2 mil millones al año que gastan en él. Toma cualquier otro virus, gasta $ 2 mil millones y también puede inventar algunos misterios grandiosos al respecto”.

Para el funcionamiento de la PCR se requiere:

– La muestra con el contenido de DNA.

– Los nucleósidos se añaden y serán los que conforman las copias del DNA molde.

– La DNA polimerasa es el enzima que se encarga de realizar la replicación de los fragmentos de DNA.

– Cebadores; los cebadores son pequeñas secuencias de DNA no codificante que son necesarios para iniciar la transcripción del DNA. Estos pequeños polinucleótidos son los que ofrecen la especificidad, fundamentales para poder determinar el fragmento replicado.

Posteriormente se mezclan los componentes descritos y se introducen en el termociclador, donde, por medio de la modificación de la temperatura (un proceso que consta de tres etapas), dará lugar a la desnaturalización de las hebras de DNA. Estas se separan para posteriormente bajar la temperatura y se fijen los cebadores. Por último, se sube de nuevo la temperatura hasta que se inicia la actividad de la polimerasa realizando la replicación.

Este proceso conduce a la duplicación del DNA diana, de forma que al realizar cerca de 40 ciclos obteniéndose cientos de millones de copias.

Ahora vamos a traducir esto para ser entendido por cualquiera. Estas palabras científicas dificultan la comunicación y contribuyen a que muchas personas se sientan inhibidas de preguntar o “lo dejen en manos de los científicos que son los que saben de eso”.

Esto precisamente es aprovechado para imponer una prueba cuestionable como diagnóstico de una enfermedad.

Esto no se puede permitir.

Pasemos sin mas preámbulos a la explicación para Dummies de la PCR. Este es el título que hemos escogido para parafrasear, con cierta gracia, el desconocimiento lógico que usted pueda tener sobre el funcionamiento de la PCR y que al final de este programa le habrá quedado claro. No se preocupe. Allá vamos.

Imaginemos que el virus es una cadena de esas que se ponen al cuello, con sus eslabones.

Estos eslabones, cada uno, van a ser una letra de ADN. El ADN sólo tiene 4 letras (A,C,G,T).

Imaginemos por tanto que los eslabones son de cuatro colores diferentes.

Como muchos sabréis el virus es de ARN pero para esta prueba, se convierte en ADN previamente. La única diferencia entre uno y otro es que la cadena sería doble bicatenaria como una escalera o sencilla monocatenaria como la misma escalera partida por la mitad  pero los colores de los eslabones serían los mismos.

Así que ya tenemos nuestro virus convertido en una cadena de eslabones de ADN. Imaginaos la imagen de una cadena. ¿Ya la tenéis? Esa cadena tiene 30 000 eslabones. Es muy larga.

Para realizar la prueba analizaremos 3 fragmentos de unos 150 eslabones como mucho cada uno, que son los que analiza la prueba.

¿Y por qué 150?

Porque aunque el genoma viral para el SARS-CoV-2 es de aprox. 30 000 eslabones o bases, los test de diagnóstico PCR para virus respiratorios generalmente se dirigen a una pequeña región del genoma viral que suele ser de 80-150 pb o sea de 80 a 150 eslabones cada pedacito. Esto se denomina gen.

Seleccionemos en nuestra cabeza o si queréis en un papel, 3 pedacitos, uno al principio, uno al medio y otro al final de la cadena. Comparados con el total de la cadena serán trozos muy pequeños. Entre los 3 analizaremos 450 eslabones como máximo ( o sea 150 de cada pedazo) de esa larga cadena de 30 000.

¿Ya os dais cuenta de que son pocos verdad? Pero eso es lo que hace la PCR para decir que ese es el bicho.

Ahora imaginemos que esos 3 pedacitos los vamos a multiplicar muchas veces, vamos a hacer lo que se llama una reacción de amplificación. Para hacer esto, necesitamos un aparato del laboratorio que se llama termociclador, pero como nosotros no lo tenemos, vamos a imaginar que tenemos que poner nuestra cadena en una termomix.

Vamos entonces a analizar los 3 pedazos que por su secuencia de eslabones serán del bicho y por tanto identificarían que ese es nuestro bicho o cadena.

Esos 3 pedazos solo se pueden multiplicar si se unen a unos trocitos de eslabones que les vamos a aplicar. Estos son microscópicos y vienen ya diseñados en un kit. Usted solamente debe echar el contenido en la termomix y programar el tiempo que le indica el fabricante.

Los trocitos de 20 eslabones que no hacen mas nada que marcar el inicio y el final de donde se debe formar el molde, son una especie de junta a la que se pega en el inicio y al final del segmento. Esto se llama cebador o primers. Es también una manera de cerciorarse de que el molde se forma en ese pedazo y no en otro. El molde lo ira formando la ADN polimerasa(que es la enzima que le da nombre a esta prueba ) a partir de eslabones sueltos de las 4 letras o colores que también vienen en el kit, o sea va rellenando el agujero que hay entre los cebadores.

Recuerde que usted no ve nada, todo le viene preparado por un fabricante y es microscópico.

Se supone que el cebador tiene una sustancia fluorescente, que emite luz y esa luz es la que va a detectar la termomix para decir, a cierto límite, ya calculado (supongamos que tras 2h y media de cocción por ejemplo que es lo que suele tardar esta parte de la PCR de coronavirus) que ahí está el bicho o cadena, o mas bien, los 3 pedacitos que tras la cocción se han multiplicado.Cada vez que realizamos un ciclo volvemos a partir por la mitad la cadena y donde teníamos 8 trozos obtendremos 16 y así sucesivamente en una progresión geométrica.

Y esto es todo. La PCR por tanto, analiza 3 pedacitos muy pequeños de la cadena que es el bicho y para ello solo tiene que echar un kit o preparado de paella y darle un tiempo de cocción. Eso es lo que determina que alguien tiene esta enfermedad, un kit del fabricante y una termomix que cocina nuestra cadena por un determinado tiempo.

– Ahora bien, os dije que solo hay 4 letras para los eslabones así que lo importante aquí es el orden de los colores de los eslabones. Esto es lo que se denomina secuencia.

La oficialidad dice que esto es muy específico porque ese orden de eslabones que están en nuestros pedacitos escogidos son únicos del bicho. Pero volvemos a lo mismo, no son fragmentos tan grandes, y solo hay 4 letras. ¿Existe la posibilidad de que esas 4 letras en ese orden no se puedan encontrar en otros virus no descubiertos o incluso en partes de nuestro propio ADN? ¿Es mas, es cierto que ese orden de eslabones que utilizan 4 letras sean tan únicas del bicho como dicen? Pues no.

Esos trocitos, que se llaman genes y que son 3 en la PCR que usamos, no son únicos del bicho. Son de la familia del bicho en al menos 2 de los pedacitos y en el tercero al 50%. Así que de los 450 eslabones, 300 serían de cualquier virus de la familia del coronavirus y el que dicen que es específico, a la mitad. Nos quedarían 75 eslabones para decir que es el bicho, eso si, en una determinada secuencia.

Ahora que habéis entendido cómo funciona la prueba, vamos a ponerles nombre a los 3 pedacitos de cadena o genes. Se llaman gen N, gen E y gen RdRp. E codifica una de las proteínas de la envuelta del virus. N codifica la proteína de la nucleocápsida o armazón proteico del virus y RdRp, la enzima que copia el ARN del virus, llamada transcriptasa dependiente de ARN.

En general N y el E son comunes a todos los coronavirus. El RdRp se dice que es especifico pero inicialmente se describió como común  a todos los coronavirus, como consta en informe del 6 de Febrero del Ministerio de Sanidad. Y es que solo una secuencia es única de Sars cov2, o sea unos pocos eslabones (los 75 que calculamos).

Como ejemplo, las tres pruebas de diagnóstico recomendadas por el Centro para el Control de Enfermedades de los EE. UU. (CDC) tienen solo 65, 67 y 72 nucleótidos.

No he podido encontrar las secuencias del gen E, N y rdrp para decir con exactitud de cuantas bases consta así que para ser justos, era mejor calcularlos al máximo tamaño de un gen para estas pruebas. Esto es 150 bases.

Las regiones del genoma vírico que reconocen las sondas de ADN varían según la prueba de que se trate: la diseñada en el Hospital de la Charité (Cristian Dresden) reconoce regiones del gen E que son comunes a todos los coronavirus, así como del gen RdRp, que alberga la enzima responsable de la multiplicación del genoma vírico.

La del Instituto Nacional de Salud de Tailandia sólo tiene en cuenta el gen N, común a todos los coronavirus y otros países aplican otros tipos de cebadores dirigidos a otros genes diana…vamos, de locos.

Las secuencias del supuesto virus que se buscan en este kit de caldo para paella no son secuencias que no estén en nuestro propio ADN tal y como se comentaba en el artículo de burbuja y les invito a que las comprueben por vds mismos en alguna de las bibliotecas del genoma humano que hay disponibles en red como BLAST.

La Doctora María José Martínez Albarracín, Catedrática en Procesos Diagnósticos Clínicos ha publicado en su Facebook que una de esas cadenas genicas que se buscan en el PCR la tenemos en el cromosoma 8 de nuestro propio ADN.

Como explicamos antes estas secuencias específicas a buscar cambian de un pais a otro y de un instituto de salud a otro…ese tan manido consenso de “lo que dice la ciencia” no es ni por asomo cierto. En este documento de la OMS donde se explican todos los protocolos existentes para realizar PCR podemos verlo. (Otro enlace por si “se pierde” el de la OMS)

En dicho documento podemos ver que nunca se debe pasar de los 40 ciclos ya que amplificariamos cualquier cosa que hubiera en la muestra ya que una vez superada la etapa exponencial ya debería ser suficiente.

En este dibujo nos muestran cómo hasta los 20 a 30 ciclos, a partir de la línea verde, no deberíamos de validar la prueba y como el umbral de detección debe ser ajustado para caer dentro de la fase exponencial de PCR.

Siempre debemos estar por debajo de los 40 ciclos ya que por encima vamos a tener muchos falsos positivos.

Imaginense que con esta técnica tenemos que buscar una aguja en un pajar y que dicha técnica nos permite ir haciendo mas grandes los objetos metálicos. Pero nunca vamos a poder ver los objetos, solo veremos una luz fluorescente que es lo que se le añade a la aguja. La aguja va creciendo en cada ciclo y la paja se queda como esta. Lógicamente llegará un momento que la aguja “saltara a la vista”, brillará.

Pero, ¿y qué ocurre con los otros objetos metálicos que hay en el pajar?

Pues lo que ocurre es que también crecen y por lo tanto vamos a poder ver que la moneda, o la arandela o el clavo que estaba en dicho pajar va a brillar tambien si nos pasamos de numero de ciclos. Ese es el error que no queremos.

Pero imaginense que ni tan siquiera pudiéramos estar seguros de que la aguja y la moneda no fuesen lo mismo. Y eso es lo que ocurre en este caso, las supuestas secuencias específicas de este supuesto virus están en nuestro ADN y por ello esta prueba queda totalmente invalidada.

Y lo hemos comprobado.

Hemos buscado en BLAST todas esas secuencias TAAAAAAN específicas que nos dice el CDC (máximo órgano jurisdiccional para controlar una pandemia) de ese supuesto SarsCov2 y las hemos encontrado todas en nuestro ADN.

Todas. Correspondencia del 100% con todo esto. Cromosomas 1,2, 3,6,8,18 y X

También en el cromosoma 9.

No hace falta que les diga que cuando nos hurgan con el hisopo hasta el cerebro para proceder al cepillado de la mucosa respiratoria nos extraen miles y miles de células y por tanto extraen nuestro ADN que contiene entre muchos otros este trozo de cadenas de nucleótidos.

Algunos estudios incluso sugieren que esta toma de muestras en caso de dañar nuestro epitelio nasal, el revestimiento interior de la nariz, podrían facilitar la entrada a bacterias oportunistas eludiendo la barrera hematoencefálica.

La única forma de salir de esta vorágine de nuevos infectados asintomáticos es hacer lo que recomienda el doctor Claus Köhnlein, NO REALIZAR TEST PCR.

Por si desaparece.

Misteriosamente hemos podido comprobar como muchas otras enfermedades contagiosas desaparecian del mapa como podemos ver en el Informe epidemiológico de la semana 21 de la comunidad de Madrid.

 

La tendencia de la gripe es de tener un pico máximo de incidencia cada cuatro años, y este año tocaba que fuera mas fuerte que la temporada 2018-2019 pero sin embargo no ha ocurrido así, todo ha sido Covid-19.

Otras enfermedades como el asma dejaron de molestar a la población. Yo me pregunto si tendría que ver la prácticamente nula fumigación de nuestras ciudades mediante la geoingeniería con la ausencia de episodios asmáticos…eso si, como muy bien dicen ellos estos datos debido a la epidemia de Covid-19 deben tomarse con cautela.

Misteriosamente los otros brotes epidémicos habían desaparecido.

Todo era Covid-19. En abril teníamos tasas de mortalidad en hombres sobre el total de casos notificados de un 12%

¿Los casos notificados son casos confirmados a través de una prueba PCR? Evidentemente no, como podemos ver en este gráfico y en la descripción de casos confirmados por PCR positiva.

La sociedad española no está tan sana como aparenta y nuestros mayores cuentan con factores de riesgo de mas de un 70% en este tipo de enfermedades respiratorias.

Sin embargo aqui estamos, en pleno verano sin prácticamente ningún fallecido por el bicho y disfrutando de llevar un bozal. Y todo ello por los famosos rebrotes obra y milagro de realizar pruebas PCR a gente sana.

Y es que este kit de caldo para paella puede dar positivo a cualquier cosa como una papaya o sangre de cabra como muy bien explicó el presidente de Tanzania, doctor en química y profesor universitario.

Por si desaparece…que a Youtube lo carga el diablo.

Unas muestras congeladas del 2017 pueden dar PCR positivo al Covid-19 tal y como se le escapó al Dr. César Carballo en el programa de Iker Jiménez…preguntense porque si es tan contagioso y tan letal no nos enfermamos hace ya tres años.

En el brillante artículo titulado ¿Fue la prueba COVID-19 diseñada para detectar un virus? escrito por Celia Farber podemos comprobar que esta técnica no fue diseñada para detectar un virus si no para fabricar ADN.

Como bien dice Celia Farber o el doctor Claus Köhnlein los tratamientos inadecuados o sumamente peligrosos como la intubación han causado más muertes que la infección por este supuesto virus.

Como bien nos dicen los propios médicos “las infecciones adquiridas en el nosocomio (hospital, fijense que palabreja utilizan) o relacionadas con la asistencia sanitaria son unos de los grandes retos de seguridad del paciente”.

¿Cuál es la relación entre la propagación de las pruebas y la “propagación” de un nuevo virus? ¿Cómo sabemos lo que estamos experimentando, en comparación con lo que asumimos que estamos experimentando? Un estudio en Austria descubrió que el aumento de las pruebas se correlacionó con, sin sorpresa, un aumento de “casos”.

En una discusión por correo electrónico entre un grupo de científicos, académicos y médicos internacionales, se planteó la pregunta de si el número diario de nuevos casos se seguiría con el número diario de pruebas.

“Sí, lo hacen”, escribió el doctor austriaco Christian Fiala. “Aquí están los datos de Austria. En otras palabras, si quieren aumentar aún más el número de personas ‘infectadas’, también deben aumentar el número de pruebas. Sin embargo, eso es físicamente imposible.

Otro aspecto: durante las primeras semanas la mayoría de las pruebas se realizaron en personas enfermas. Por tanto, el porcentaje de pruebas positivas fue relativamente alto. Pero no hay tantas personas enfermas y con el despliegue general de las pruebas, la gran mayoría de las que se hicieron las pruebas estarán sanas. En consecuencia, el porcentaje de pruebas positivas será bajo y la mayoría serán falsos positivos.

En otras palabras, es imposible continuar con el aumento de resultados positivos de las pruebas “.

“El Dr. Mullis escribió el 7 de mayo de 2013:

“La PCR detecta un segmento muy pequeño del ácido nucleico que forma parte del propio virus. El fragmento específico detectado se determina mediante la elección algo arbitraria de los cebadores de ADN utilizados que se convierten en los extremos del fragmento amplificado.”

Si las cosas se hicieran bien, la “infección” estaría muy lejos de una prueba de PCR positiva.

“Hay que tener una enorme cantidad de cualquier organismo para causar síntomas. Enormes cantidades ”, me dijo el Dr. David Rasnick, bioquímico, desarrollador de proteasas y ex fundador de un laboratorio de EM llamado Viral Forensics. “No comienzas con las pruebas; empiezas por escuchar los pulmones. Soy escéptico de que una prueba PRC sea cierta. Es una gran herramienta de investigación científica. Es una herramienta horrible para la medicina clínica. El 30% de sus células infectadas han muerto antes de que muestre síntomas. En el momento en que muestra los síntomas … las células muertas están generando los síntomas “.

Le pregunté al Dr. Rasnick qué consejo tiene para las personas que quieren hacerse la prueba del COVID-19.

“No lo hagas, digo, cuando la gente me pregunte”, responde. “Ninguna persona sana debería hacerse la prueba. No significa nada, pero puede destruir tu vida, hacerte absolutamente miserable“.

Cada vez que alguien toma un hisopo, una muestra de tejido de su ADN, ingresa en una base de datos del gobierno. Es para rastrearnos”, dice David Rasnick. “No solo buscan el virus. Pon eso en tu artículo “.

Realicé una entrevista de dos horas con David Crowe, investigador canadiense, licenciado en biología y matemáticas, presentador del podcast The Infectious Myth y presidente del grupo de expertos Rethinking AIDS. Desglosó los problemas con la prueba de Corona basada en PCR con gran detalle, revelando un mundo de complejidad inimaginable, así como engaños.

“Lo primero que debe saber es que la prueba no es binaria”, dijo. “De hecho, no creo que existan pruebas para enfermedades infecciosas que sean positivas o negativas“.

La siguiente parte de su explicación es extensa y detallada, pero sigamos adelante:

“Lo que hacen es tomar una especie de continuo y arbitrariamente dicen que este punto es la diferencia entre positivo y negativo”.

“Wow”, dije. “Eso es tan importante. Creo que la gente lo ve como una de dos cosas: positivo o negativo, como una prueba de embarazo. “Lo tienes” o no “.

“La PCR es realmente una técnica de fabricación”, explicó Crowe. “Empiezas con una molécula. Empiezas con una pequeña cantidad de ADN y en cada ciclo la cantidad se duplica, lo que no parece tanto, pero si, si duplicas 30 veces, obtienes aproximadamente mil millones de veces más material del que empezaste. Entonces, como técnica de fabricación, es genial. Lo que hacen es unir una molécula fluorescente al ARN a medida que lo producen. Usted hace brillar una luz en una longitud de onda y obtiene una respuesta, recibe luz enviada de regreso a una longitud de onda diferente. Entonces, miden la cantidad de luz que regresa y ese es su sustituto de la cantidad de ADN que hay. Estoy usando la palabra ADN. Hay un paso en la prueba de RT-PCR que es donde se convierte el ARN en ADN. Entonces, la prueba de PCR en realidad no usa el ARN viral. Está usando ADN pero es como el ARN complementario. Entonces, lógicamente, es lo mismo, pero puede resultar confuso. ¿Por qué de repente estoy hablando de ADN? Básicamente, hay una cierta cantidad de ciclos “.

Aquí es donde se vuelve salvaje.

“En un artículo”, dice Crowe, “encontré 37 ciclos. Si no obtuvo suficiente fluorescencia en 37 ciclos, se lo considera negativo. En otro documento, el límite era 36. Treinta y siete a 40 se consideraron “indeterminados”. Y si llegaba a ese rango, hacía más pruebas. Solo he visto dos artículos que describían cuál era el límite. Por lo tanto, es muy posible que diferentes hospitales, diferentes estados, Canadá versus EE. UU., Italia versus Francia estén usando diferentes estándares de sensibilidad de corte de la prueba Covid. Entonces, si corta a los 20, todos serían negativos. Si cortas un 50, es posible que todos estén positivos “.

Les recomiendo leer completo el artículo de Celia Farber y tambien el aún mas controvertido Las pruebas de PCR COVID19 no tienen sentido científico” redactado por Torsten Engelbrecht y Konstantin Demeter.

Muy probablemente su navegador les indique que se trata de una web no confiable o que incluso podría entrar algun virus en su ordenador al visitar esta web. Nada más lejos de la realidad, simplemente se trata de una web que para Google y otras empresas que controlan la red es un sitio conspiranoico. Lean el articulo y luego extraigan sus conclusiones.

En dicho artículo les mostrarán cómo los fabricantes incluyen en sus prospectos la indicación de que la prueba PCR no sirve para diagnosticar ninguna enfermedad, por supuesto incluyendo el Covid-19. Detectar una pequeña cadena de ADN supuestamente perteneciente a un virus no podrá nunca determinar que estamos enfermos por un supuesto virus.

Test PCR donde sus fabricantes indican que no sirven para diagnosticar. Pueden descargar los prospectos en PDF.

Test PCR VIASURE

Test PCR VITRO

 

Test PCR RealCycler Monotest CORO v.5.2

test PCR GSD NovaPrime

test PCR Canvax

test PCR canvax 1

test PCR canvax 2

test PCR Viasure S gene

Ya lo ven, los fabricantes lo dicen abiertamente. Sus test solo sirven para investigación, no sirven si no van acompañados de un estudio clínico del paciente, su anamnesis, o sea el conjunto de datos que se recogen en la historia clínica de un paciente con un objetivo diagnóstico. También nos dicen que el diagnóstico de una infección no solamente se debe basar en el resultado de la PCR. Aconsejan asimismo que los resultados de la PCR se comprueben mediante métodos alternativos como un cultivo o la propia secuenciación del supuesto virus detectado.

La prueba como pueden ver en este gráfico de la Sociedad Española de Enfermedades infecciosas y microbiología clínica  debería ser lo último a realizar en caso de duda, solo para asegurarnos 100% de que un paciente “que presenta síntomas” no padece este covid19.

Mientras tanto las televisiones, todas, están aterrorizando a la población con fabulaciones, exageraciones y mentiras como esta del número de infectados en un pequeño pueblo de la sierra de Madrid. La Serna del Monte tiene +700 casos por cada 100.000 habitantes. Lógicamente el televidente medio habrá quedado con la boca abierta tras esta abultada cifra de positivos por coronavirus.

Imagen ofrecida por la Secta, perdón, por la Sexta.

Pero da la casualidad que la gente que conoce ese pueblo sabe que no pasa de los 100 habitantes, concretamente en el último censo fueron 77. Así que no hay material humano donde hacer pruebas PCR a +700.

¿Qué quiere decir entonces ese dato de +700 casos por cada 100.000 habitantes?

Pues que si tuvieran 100.000 habitantes tendrían 700 o más positivos, pero traduciendolo mediante una simple regla de tres obtenemos esto:

¿Como le pudieron hacer la PCR a medio habitante de La Serna del Monte? ¿Nos explicará este misterio Iker Jiménez en alguno de sus próximos programas?

Lo único que sabemos es que si tenemos la mala suerte de dar positivo en uno de estos kits de caldo para paella nos van a incomunicar por la cara.

No queremos verlo pero estamos viviendo en una nueva época del auge del nazismo.

¡Luego se preguntarán que porque nadie hizo nada, que porque nadie lo impidió!

Somos todos nosotros los que tenemos que reaccionar e impedir que esta locura vaya a más.

En cualquier momento podemos recibir una carta como esta para exigirnos que nos hagan una PCR.

No lo consientan. No permitan que les realicen una prueba que no sirve para diagnosticar que están enfermos y mucho menos para indicar con absoluta seguridad que es por culpa de un virus. Pueden hacerles la vida imposible y convertirlos en poco menos que unos presos políticos como al italiano que lleva asilado desde el 17 de abril tras haber dado 17 positivos.

Di no a esta nueva normalidad nazi. Pronto irán casa por casa realizando test PCR si es necesario e intentarán vacunar por la fuerza a la población de un supuesto coronavirus para el que nunca han logrado fabricar una vacuna.

Necesitan víctimas sanas…

…como los vampiros chupasangre que son.

Tienen un podcast sobre esto titulado

UTP96 PCR explicada para niños


Otros enlaces

Solo para uso en investigación 2019-Nuevo coronavirus (2019-nCoV) Cebadores y sondas de RT-PCR en tiempo real

https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html

Tasa potencial de falsos positivos entre las ‘personas infectadas asintomáticas’ en contactos cercanos de pacientes con COVID-19

https://pubmed.ncbi.nlm.nih.gov/32133832/

Reacción en cadena de la polimerasa

https://es.wikipedia.org/wiki/Reacci%C3%B3n_en_cadena_de_la_polimerasa

Precio de los test PCR

https://www.biosearchtech.com/products/pcr-kits-and-reagents/pathogen-detection/2019-ncov-cdc-probe-and-primer-kit-for-sars-cov-2

Mascarillas y Bacterias

https://www.youtube.com/watch?v=yzJKIVM9AGE&

Mascarillas y Bacterias parte 3

https://www.youtube.com/watch?v=o-jwWjqb4_M&

Muere Kary Mullis, el Nobel que negaba la existencia del virus del sida y del cambio climático

https://elpais.com/elpais/2019/08/13/ciencia/1565717605_558894.html

Tuit de Nozick donde Kari Mullis explica en su libro autobiografico como fue expulsado sin poder exponer nada de la conferencia de Toledo

https://twitter.com/nozick1/status/1282386129371758592

Christian Drosten. Virólogo que empezó a utilizar las pruebas PCR para el sarcov2

https://en.wikipedia.org/wiki/Christian_Drosten

Manual para dummies ¿por qué el test PCR no sirve en absoluto para detectar el Covid?

https://www.burbuja.info/inmobiliaria/threads/manual-para-dummies-por-que-el-test-pcr-no-sirve-en-absoluto-para-detectar-el-covid.1331965/

El Dr. Kary Mullis Premio Nobel de Química 1993 dice que el PCR no detecta carga viral

https://videos.utahgunexchange.com/watch/el-dr-kary-mullis-premio-nobel-de-quimica-1993-dice-que-el-pcr-no-detecta-carga-viral-mp4_JgZTprRTP4HpbS2.html

Sida- La duda. Desinformación y ocultación de los medios (Youtube)

https://www.youtube.com/watch?v=3G4_8Ds2b84&

Sida- La duda. Desinformación y ocultación de los medios

https://videos.utahgunexchange.com/watch/sida-la-duda-desinformacio-n-y-ocultacio-n-de-los-medios-mp4_DWU6fWvxBqg8prP.html

Los laboratorios de los CDC fueron contaminados, retrasando las pruebas de coronavirus, dicen los funcionarios

https://www.nytimes.com/2020/04/18/health/cdc-coronavirus-lab-contamination-testing.html

Hilo sobre test contaminados PCR

https://twitter.com/tecn_preocupado/status/1253330556789460993

Tricare militar accidentalmente le dijo a más de 600,000 personas que habían tenido coronavirus

https://americanmilitarynews.com/2020/07/military-tricare-accidentally-told-600000-people-theyve-had-coronavirus/

Posible causa de la pandemia por coronavirus:

Interferencia inmunológica entre el POLISORBATO 80 de la vacuna antigripal adyuvada y el SARS-CoV-2

https://twitter.com/tecn_preocupado/status/1275825671508496386

Pacientes con COVID = Paciente con Hemoparasitos.

https://twitter.com/EliteMonarca/status/1287012229473337345

Científicos de la Autónoma y UTalca publican artículo en prestigiosa revista Nature Biotechnology

https://www.uautonoma.cl/news/cientificos-de-la-autonoma-y-utalca-publican-articulo-en-prestigiosa-revista-nature-biotechnology/

Dr. Cesar Carballo muestras congeladas 2017 prueba positiva PCR

https://videos.utahgunexchange.com/watch/dr-cesar-carballo-muestras-congeladas-2017-positivo-prueba-pcr-mp4_qhMuf4pdYyHg46d.html

https://d2servp9jyqzxd.cloudfront.net/prd-ugetube-vod-convert-source-1j0ko23jm6jtr/2020/08/NNfbc2d3ZTwl7Mfk5Xwy_01_2953_c9d28aab9e1a80a805f1462f84cb693d.mp4

El Dr Cesar Carballo dice que muestras congeladas del 2017 daban positivo a la prueba PCR

https://twitter.com/LEVANNTE/status/1288763776343461888

¿Fue la prueba COVID-19 destinada a detectar un virus?

https://uncoverdc.com/2020/04/07/was-the-covid-19-test-meant-to-detect-a-virus/

Las pruebas de PCR COVID19 carecen de sentido científico (articulo muy bueno alojado en una página llamada conspiranoica)

https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/

Las mentiras diagnósticas del Coronavirus

https://tecnicopreocupado.com/2020/07/08/las-mentiras-diagnosticas-del-coronavirus/

Ministerio de Sanidad, Consumo y Bienestar Social. Estudio Nacional de sero-Epidemiología de la Infección por SARS-CoV-2 en España (ENE-Covid) Preguntas y respuestas frecuentes (pregunta 5 y 6)

https://www.mscbs.gob.es/ciudadanos/ene-covid/faqs.htm

¿Me va a dar el resultado de la prueba por escrito?

Sí, le daremos el resultado del test rápido de anticuerpos por escrito. Sin embargo, es importante que sepa que este test no permite diagnosticar si usted tiene COVID-19.

Este test no diagnostica la enfermedad. Haber tenido contacto con el coronavirus no significa estar enfermo.

Tampoco nos dice si usted es contagioso o no, es decir, con este resultado no sabemos si usted puede trasmitir o no el virus a otras personas.

Su resultado (positivo o negativo) será útil cuando, en un análisis estadístico posterior, se combine con el de otros participantes para tener datos sobre el grado de contacto de la población española con el virus.

¿El test que me van a hacer es fiable?

EL COVID19 es una enfermedad nueva y estos tests que miden si ha habido contacto previo con el virus se han desarrollado recientemente y por tanto la información de cómo funcionan se acaba de generar y no existen por el momento grandes estudios de validación, como nos gustaría. El test tiene el certificado de la Comunidad Europea. No obstante, antes de iniciar ENE-COVID19 (este estudio), hemos probado esta herramienta para confirmar que funciona bien, es decir, que detecta si están presentes los anticuerpos que demuestran que ha habido un contacto anterior con el virus. Se ha probado en alrededor de 100 personas que ya pasaron la enfermedad y en muestras donadas que se utilizaron para diagnosticar otras enfermedades y se habían obtenido antes de que el coronavirus estuviese aquí. Los resultados obtenidos muestran que el test tiene alta sensibilidad y especificidad (mayores al 80%), es decir detecta bastante bien el contacto con el virus. No obstante, necesitamos más información y por eso en este estudio vamos a recoger otros tipos de muestra para poder comparar, cuando dispongamos de mejores herramientas.

Es importante que tenga en cuenta que medir el contacto con el coronavirus no es suficiente para diagnosticar COVID19 y tampoco nos dice si usted es o no contagioso en este momento.

La fe en la prueba rápida conduce a una epidemia que no era

https://www.nytimes.com/2007/01/22/health/22whoop.html

María José Martínez Catedrática univ Murcia

https://videos.utahgunexchange.com/watch/mari-a-jose-marti-nez-catedra-tica-univ-murcia-pruebas-pcr-mp4_3L3AqYnX2Npnxw4.html

“La OMS ha actuado como instrumento de manipulación mundial” (excelente entrevista a la Dra María José Martínez Catedrática univ Murcia)

“La OMS ha actuado como instrumento de manipulación mundial”

Test PCR detecta exosomas

https://videos.utahgunexchange.com/watch/test-pcr-2-mp4_mnQtYsbOktHc1R6.html

Merienda con Luis de Miguel

https://www.youtube.com/watch?v=v3jBEqwlGZA&

Y en su web se detallan todos los pasos legales administrativos a seguir si nos quieren hacer una prueba y lo que debemos exigir sobre el test en sí mismo.

https://www.scabelum.com/post/__pcr

Jefe de la OMS dice que ciertos rebrotes de COVID-19 se deben a “jóvenes que bajan la guardia”

https://lta.reuters.com/articulo/salud-coronavirus-oms-idLTAKCN24V2YK-OUSLT?taid=5f22feff31ce9a000122a602&utm_campaign=trueAnthem%3A+Trending+Content&utm_medium=trueAnthem&utm_source=twitter

Asistentes a discotecas valencianas con brotes de covid-19 se niegan a hacerse test

https://www.elconfidencial.com/espana/comunidad-valenciana/2020-07-30/asistentes-discotecas-con-brotes-se-niegan-a-hacerse-test_2701031/

COVID-19 sufre modificaciones genéticas a lo largo del tiempo que es necesario seguir. Aunque hay cebadores de la técnica de PCR que pueden no detectar la presencia de COVID-19, como el protocolo requiere la identificación de objetivos múltiples de COVID-19, se reducen las probabilidades de obtener resultados de identificación de la presencia de COVID-19 falsamente negativos.

https://www.iacs.es/covid-19-sufre-modificaciones-geneticas-a-lo-largo-del-tiempo-que-es-necesario-seguir-aunque-hay-cebadores-de-la-tecnica-de-pcr-que-pueden-no-detectar-la-presencia-de-covid-19-como-el-protocolo-requ/

Presidente de Tanzania denuncia graves irregularidades en gestión del Coronavirus.

https://www.youtube.com/watch?v=6mQMXKrL58k&&feature=emb_logo

https://d2servp9jyqzxd.cloudfront.net/prd-ugetube-vod-convert-source-1j0ko23jm6jtr/2020/05/X5hlRrrtfzKYpWExwCic_09_2217_22b2d820a38dd9bc09dc50b407b16a78.mp4

Test PCR donde sus fabricantes indican que no sirven para diagnosticar

Test PCR VIASURE

https://open.lbry.com/@tecnico.preocupado:7/IU-NCO212enes0420-rev.01:e

Test PCR VITRO

https://open.lbry.com/@tecnico.preocupado:7/MAD-003941M_22720_2138_MAD-003941M-FT-ES-Completa-2020-07-16:d

Test PCR RealCycler Monotest CORO v.5.2

https://open.lbry.com/@tecnico.preocupado:7/Manual-deinstruccionesCOROv.5.2:d

test PCR GSD NovaPrime

https://open.lbry.com/pcov603x_6-sprachig_2020-07-14:9

test PCR Canvax

https://open.lbry.com/@tecnico.preocupado:7/qMAXSen™-Coronavirus-SARS-CoV-2-RT-qPCR-detection-Kit-E-and-RdRp-gene-assays:a

test PCR canvax 1

https://open.lbry.com/@tecnico.preocupado:7/qMAXSen™-Coronavirus-SARS-CoV-2-RT-qPCR-Detection-Kit-N-and-RNAse-P-genes-based-Assay:5

test PCR canvax 2

https://open.lbry.com/@tecnico.preocupado:7/qMAXSen™-Coronavirus-SARS-CoV-2-RT-qPCR-Detection-Kit-RdRp-gene-assays:d

test PCR Viasure S gene

https://open.lbry.com/@tecnico.preocupado:7/VS-NCO124enes0420-rev-02:4

Un hombre permanece aislado en Italia tras 17 test positivos de Covid-19

https://www.abc.es/sociedad/abci-hombre-permanece-aislado-italia-tras-17-test-positivos-covid-19-202007231415_noticia.html

Toma de muestras (explicación)

https://www.youtube.com/watch?v=o6cb6uNyGSU&

Daños en el interior de la nariz da ‘vía libre’ a las bacterias para llegar al cerebro

https://www.elconfidencial.com/tecnologia/ciencia/2020-03-18/dano-nariz-bacterias-cerebro-enfermedad_2504280/

La leyenda del tablero de ajedrez y los granos de trigo

https://matematicascercanas.com/2014/03/10/la-leyenda-del-tablero-de-ajedrez-y-los-granos-de-trigo/

Las Vacunas contra el coronavirus han fallado durante décadas

https://cienciaysaludnatural.com/las-vacunas-contra-el-coronavirus-han-fallado-durante-decadas/

Programa 46 con Maria Jort (Maria desilumínate) donde hablamos sobre la realidad oculta de la pandemia

https://www.ivoox.com/programa-46-maria-jort-maria-desiluminate-donde-audios-mp3_rf_50920792_1.html

DEL PANICO Y LA NEGLIGENCIA A LA INVERSION EN SEGURIDAD SANITARIA. FINANCIACION PARA LA PREPARACION  ANTE UNA PANDEMIA A NIVEL NACIONAL (2017/2018)

https://desmontandoababylon.com/2020/05/03/del-panico-y-la-negligencia-a-la-inversion-en-seguridad-sanitaria-preparacion-ante-futuras-pandemias-a-nivel-nacional/

Event 201, simulacro de coronavirus La parte dedicada al tratamiento en los medios

https://desiluminate.org/2020/04/20/event-201-simulacro-de-coronavirus-la-parte-dedicada-al-tratamiento-en-los-medios/

Memorando del Banco Mundial: Desde el Pánico y la Negligencia a la inversión en seguridad sanitaria. (Blog Maria Desiluminate)

https://desiluminate.org/2020/06/04/memorando-del-banco-mundial-desde-el-panico-y-la-negligencia-a-la-inversion-en-seguridad-sanitaria/

Orden de 16 de julio de 1996 por la que se declara a doña Josefa Martínez Albarracín aprobada en el proceso para la adquisición de la condición de Catedrática en los Cuerpos de Profesores de Enseñanza Secundaria, convocado por Orden de 5 de diciembre de 1994.

https://www.boe.es/diario_boe/txt.php?id=BOE-A-1996-20655

Links y papers de información pruebas pcr:

https://www.sciencemag.org/news/2020/02/united-states-badly-bungled-coronavirus-testing-things-may-soon-improve

https://www.fda.gov/media/134922/download

https://www.sciencedirect.com/topics/immunology-and-microbiology/virus-nucleocapsid

https://edition.cnn.com/2020/03/21/politics/us-coronavirus-tests-invs/index.html

https://www.cdc.gov/media/releases/2020/t0212-cdc-telebriefing-transcript.html

https://www.the-scientist.com/news-opinion/how-sars-cov-2-tests-work-and-whats-next-in-covid-19-diagnostics-67210

https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance

https://www.npr.org/sections/health-shots/2020/03/26/822084429/in-defense-of-coronavirus-testing-strategy-administration-cited-retracted-study

https://www.ncbi.nlm.nih.gov/pubmed/15094372

https://www.dailymail.co.uk/news/article-8171223/Britains-young-coronavirus-victims-Teen-18-youngest-casualty-RSPCA-worker-26-dies.html

https://www.spectator.co.uk/article/how-to-understand-and-report-figures-for-covid-19-deaths-

https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/877302/guidance-for-doctors-completing-medical-certificates-of-cause-of-death-covid-19.pdf

https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/deaths/bulletins/deathsregisteredweeklyinenglandandwalesprovisional/weekending20march2020

https://www.hiddensyria.com/wp-content/uploads/2020/04/COVID-19-Survellance-Bulletin-02.04.20.pdf

https://www.cdc.gov/nchs/data/nvss/vsrg/vsrg03-508.pdf

https://www.cdc.gov/nchs/data/nvss/coronavirus/Alert-1-Guidance-for-Certifying-COVID-19-Deaths.pdf

https://swprs.org/rki-relativiert-corona-todesfaelle/

https://www.faz.net/aktuell/gesellschaft/gesundheit/coronavirus/neue-corona-symptome-entdeckt-virologe-hendrik-streeck-zum-virus-16681450.html?printPagedArticle=true

https://www.thecollegefix.com/stanford-epidemiologist-warns-that-coronavirus-crackdown-is-based-on-bad-data/

Los kits de GENOMICA para la detección del Coronavirus Covid-19, listos para comercializarse.

https://www.youtube.com/watch?v=u-7pjV0gjao&

Porcentaje del total de pruebas de COVID-19 que dieron positivo

https://ourworldindata.org/grapher/covid-19-positive-rate-bar


Legal disclaimer

 

 

Publicado por tecnicopreocupado

Uno mas que se preocupa por la humanidad. Podcast de UTP traves de IVOOX. Hagamos de este mundo un sitio mas agradable para vivir. Visita mi blog: https://tecnicopreocupado.com/

7 comentarios sobre “Pruebas PCR: El kit de caldo para paellas que nos enfermó a todos

  1. A nuestros Mayores de las residencias en Madrid se los han cargado con la descarga activada transmisor del 5G y la vacuna que tenian algunos desde octubre del 19 que hace de receptor estas antenas estan puestas desde principios del 20 pueden haber utilizado varias descargas y luego enseguida a icinerar para que no queden las pruebas del ” virus “

  2. Siempre creen los dictadores que la gente es estúpida. Creen que se tragan sus mentiras y cuando se dan cuenta que no es así, dictan leyes fraudulentamente para convertir en Leyes sus mentiras. Ya te digo yo que si la gente viese a su vecino, a su primo, a su amigo morir de sometealvirus en una especie de holocausto zombie. No haría falta que legislen una mascarilla. !llevarian 7 puestas..!. Así somos los seres humanos, siempre solidarios con nosotros mismos …

    Te están domesticando como a un chucho, amaestrando como a un mono y tu sales al balcón a aplaudir…

    A Ver!, salta perrito que solo puedes tomarte una cerveza de 8 a 9 y reunirte con 6 personas que lleven zapatos florales y nada de abrazarse, besarse, nada de bailar, …..

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión /  Cambiar )

Google photo

Estás comentando usando tu cuenta de Google. Cerrar sesión /  Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión /  Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión /  Cambiar )

Conectando a %s

Este sitio usa Akismet para reducir el spam. Aprende cómo se procesan los datos de tus comentarios .

A %d blogueros les gusta esto: