Posible mecanismo de acción del cadmio como productor de casos graves adjudicados al COVID19

Artículo colaborativo de Buscadores de la verdad iniciado por Yane y redactado por Yane y UTP.


Para empezar a explicar el por qué esta intoxicación en concreto puede ser la causante de los cuadros graves responsables del 5% del grupo de gravedad que requiere UCI y que son a mi juicio, mal diagnosticados como coronavirus, hagamos una exposición del cuadro clínico que se ha venido observando durante la pandemia en el contexto del principio de marzo-abril.

Como sabéis hasta por cansancio, la VO describe esta enfermedad como causada por el virus SarsCov2 , zoonosis presente en un murciélago o pangolín que salto a humanos en Wuhan, China y que se aisló y secuenció en solo una semana, identificándolo como agente causal. Este hecho ya es más que sospechoso, pero además es que una servidora no cree en la teoría infecciosa de las enfermedades. En otro momento explicaré mis argumentos. Ahora seguidme en la posible etiología tóxica, ya que del coronavirus tenéis bastante literatura.

¿Qué síntomas son los característicos de la infección por Coronavirus?

¿A quienes afecta?

Como veréis, un 5% termina requiriendo cuidados intensivos y de ellos un 50% fallece.

¿Qué observamos en la analítica?

Tenemos un 83 % de linfopenia, o lo que es lo mismo, linfocitos disminuidos.
En casi todos los procesos virales, se observa lo contrario, o sea un aumento de los linfocitos en sangre (Linfocitosis).
La linfopenia sería un marcador de un agotamiento del sistema inmune o de una deficiencia del mismo.

Los linfocitos T constituyen la mayoría (60-80 %) del total de linfocitos periféricos, el resto comprende a los linfocitos B y las células “natural killer”.

El número de linfocitos varía con la edad, los bebés normalmente tienen recuentos más altos y los ancianos los mas bajos. Esto sucede por la normal involución del Timo, órgano en el que se activan los linfocitos T para su funcionamiento y que va involucionando con la edad.

La edad avanzada es uno de los factores de riesgo en la infección por Covid19.
Veamos ahora las causas de linfopenia, teniendo en cuenta que se enmarca con “síntomas” de una infección viral, por tanto infecciosa.

En la mayoría de los casos, ya sabemos que la enfermedad se manifiesta como la clásica gripe por influenza, que como veis, es una de las causas de linfopenia.

Observamos además otras enfermedades que tienen el común denominador de déficit del sistema inmune. En mi caso como “no creyente” del origen infeccioso de la enfermedad, entiendo que hay una predisposición de estos pacientes por su déficit inmune a ser mas “débiles” a cualquier ataque a nuestro cuerpo. La gripe estacional parece ser eso, una caída del sistema inmunológico propia del invierno por la bajada de temperaturas.

Los metales pesados suelen causar anemia y linfocitosis (aumento de los linfocitos) pero el cadmio, se comporta de manera diferente, se asocia con linfopenia.

Avancemos hacia los “cuadros” observados y corroborados por las autopsias practicadas en Italia y España único vestigio científico que nos queda para analizar el comportamiento en sangre y otros órganos.

Telecinco sabe como alegrar el día a sus feligreses aunque la primera no se quedaba atrás.

Veremos en primer lugar, los pulmones. Se habló mucho de las “neumonías atípicas bilaterales”. El hecho de indicar que las lesiones eran bilaterales sugiere entrada aérea.

Como veis aquí, en lenguaje técnico, os señalo datos que llevan a pensar en un proceso inflamatorio propio del distrés que padecían estos pacientes pero acompañado de un evidente trastorno de la coagulación (por eso la presencia de fibrina y megacariocitos, que son otro nombre que reciben las plaquetas). Esto explicaría el aumento del Dímero D que vimos antes entre los hallazgos de la analítica sanguínea. El dímero D en la sangre es un fragmento de proteína que se produce cuando un coágulo de sangre se disuelve en el cuerpo.

El daño alveolar difuso (DAD) es la clásica manifestación histológica (o sea en tejidos) del síndrome de distrés respiratorio del adulto (SDRA)/daño pulmonar agudo. La etiología es muy variada, incluyendo agentes infecciosos, inhalantes, drogas, shock, sepsis, radiación, miscelánea e idiopática. De la sintomatología destaca la hipoxemia severa, y la radiología se caracteriza por un infiltrado pulmonar difuso bilateral.

Sin embargo al principio de la pandemia los médicos estuvieron siguiendo protocolos inadecuados que llevaron a la tumba a muchos miles de pacientes.

Así que no solo podemos ver esto en un cuadro infeccioso. Ya os digo que hasta el momento no hay ningún virus capaz de hacer esto, acompañado de fenómenos tromboembólicos, sino que también lo pueden hacer tóxicos por inhalación, como nuestro presumible cadmio.

Ya en abril algunos médicos planteaban la hipótesis de que el virus estaba alterando la estructura de la hemoglobina pero sin describir que podría deberse a un metal tóxico como el cadmio.

El Dr Hany Mahfouz que fue Ministro de Educación Superior de Egipto y Ministro de Estado de Investigación Científica y tiene un doctorado en ciencias de la tierra, o sea, es un experto en minerales lo dejó caer en algunas publicaciones en Facebook que como leiamos antes corrieron como la pólvora por Wasapp.

Y es que el cadmio, produce algo similar a la llamada “gripe de los fundidores” en su entrada respiratoria. Los síntomas son los típicos de una gripe. Si la intoxicación es masiva puede llegar a provocar una neumonitis química, como esta que se está descubriendo en la autopsia y hasta la muerte por edema del pulmón.

 

La fiebre de los fundidores, que sería interpretada como una gripe, no es exclusiva del cadmio, sin embargo sigamos comparando el resto del cuadro  que produce este metal y lo que tenemos en las autopsias.

Comentemos brevemente la teoría del mecanismo de acción del coronavirus. Nos basaremos en la entrevista concedida por el Dr cardiólogo Jorge Tartaglione a Infobae y que resume bastante bien lo que se piensa hasta el momento.

Dejamos aquí el enlace para el que quiera consultarlo.
https://www.infobae.com/america/tendencias-america/2020/04/24/el-factor-hematologico-por-que-las-autopsias-en-muertos-por-coronavirus-muestran-coagulos-de-sangre-en-sus-pulmones/

El virus entraría a los pulmones, a nivel alveolar, se uniría a los receptores ACE 2 (Enzima convertidora de Angiotensina) y rompería la pared celular de las células del pulmón.

En resumen, la hipoxia o falta de oxígeno no se debe al pulmón propiamente sino a la incapacidad de la hemoglobina de transportarlo, ya que libera el hierro  y este hierro intoxica al pulmón.

Como no creemos en el virus, sustituyamos este elemento por el cadmio y veamos que ocurre esto mismo.

Ha llegado la hora por tanto, de explicar el mecanismo de acción del cadmio, pero para ello tenemos que seguirle la pista al hierro y tendremos que hablar de la ferritina, que fue anteriormente mencionada en el análisis. Se le considera un marcador de gravedad o sea, su aumento es signo de mal pronóstico.

¿Qué es la ferritina?

Podemos resumirla como una proteína que transporta y almacena el hierro.

En general, los valores bajos de ferritina están acompañados de niveles bajos de hierro. Los valores altos indican niveles altos de hierro, que se asocian a otras enfermedades que se encuentran enmarcadas en el síndrome hiperferritinemico.

La medición del valor de la ferritina se utiliza por tanto, para el control de los depósitos de hierro.

Metabolismo del hierro (enlace).
https://www.cardioteca.com/metabolismo-del-hierro.html

El hierro normalmente se encuentra en la hemoglobina, formando el grupo Hemo. Este está constituido por una molécula de hierro central que fija el oxígeno que toma en los alvéolos pulmonares para ser transportado por la sangre. En las plantas esto lo hace la Clorofila. Observad la similitud de ambas estructuras.

También está en los macrófagos pulmonares, y he aquí donde entra en juego el cadmio.

El cadmio inhibe la fosforilación oxidativa de los macrófagos pulmonares.

La fosforilación oxidativa es un proceso metabólico que utiliza energía liberada por la oxidación de nutrientes para producir adenosina trifosfato (ATP). Se calcula que hasta el 90 % de la energía celular en forma de ATP es producida de esta forma. Es la transferencia de electrones de los equivalentes reducidos NADH y FADH, obtenidos en la glucólisis y en el ciclo de Krebs hasta el oxígeno molecular, acoplado con la síntesis de ATP.  Constituye la respiración celular que ocurre en la mitocondria.

https://www.ecured.cu/Fosforilaci%C3%B3n_oxidativa

Así que al bloquear la fosforilación oxidativa, no deja a los macrófagos respirar, estos a consecuencia de ello mueren dejando expuestas sus reservas de hierro en forma de ferritina que se encontraban ahí almacenadas. Esta ferritina pasaría a la sangre rápidamente, teniendo en cuenta que los alvéolos son la zona más en contacto con ésta para el intercambio de sustancias que normalmente constituye su función.

Esto explica como el cadmio es capaz de causar las lesiones del distrés respiratorio que vimos en las autopsias, y el aumento de la ferritina que efectivamente es un marcador de la gravedad dado su aumento por destrucción de macrófagos pulmonares.

Ya en marzo estaba en el tejado de los médicos…sin embargo no se hizo nada.

El déficit de vitamina D o el nulo consumo de carne también favorecen a que nos intoxiquemos por cadmio. Recuerden que los ancianos y algunos deportistas que reconocían no comer carne y tener dietas con alto contenido de fitatos (inhibidores de la absorción de minerales contenidos en los vegetales) estuvieron entre los pacientes más graves ingresados en las UCI.

Es posible que una de las fuentes de inhalación del cadmio haya provenido de la geoingeniería o de las fumigaciones masivas con productos en zonas de riesgo (grandes ciudades, residencias de ancianos, etc)…por supuesto ésto no lo sabremos nunca.

Dentro del ciclo de Kreps, hay una enzima a la que se le hace responsable de estos cuadros, especialmente por el uso de Hidroxicloroquina: la glucosa-6-fosfato deshidrogenasa (6GDP). Este déficit es la eritroenzimopatía (alteración de las plaquetas por una enzima) más frecuente del mundo y está ligada al cromosoma X.

Si el cadmio, tal y como os expongo, es inhibidor de la fosforilación oxidativa, afectaría también al ciclo de Krebs y por tanto a la 6GDP, y sí, lejos de ayudar estaríamos empeorando el cuadro. Por tanto, no estaría recomendado su uso y sí, podría ser el responsable de muchas muertes (que no del cuadro principal) con el aumento de la ferritina que describimos, y que está presente desde el principio, y no necesariamente pasaría en los pacientes con déficit de esta enzima, pero esa condición presente sería fatal. Después de todo, somos muy duros.

Precisamente la gente que vivimos en el Mediterráneo tenemos un pequeño porcentaje de esta alteración y podría ser muy contraproducente el uso de la Hidroxicloroquina…imaginense los pobres africanos donde se prescribe para el tratamiento de la Malaria.

Prevalencia mundial del déficit de glucosa-6-fosfato deshidrogenasa

La HCQ (Hidroxicloroquina) a dosis altas o continuadas provoca efectos al parecer acumulativos (no está claro su mecanismo de acción según vademécum) en los sitios donde se sintetiza la melanina. Esta es una sustancia que da color a la piel para protegerla. Se encuentra en la piel, cabello iris, retina, genitales y hasta en el cerebro. Tiene afinidad por el tejido fibrótico pulmonar hacia donde evolucionan las lesiones de DAD que antes describía en la autopsia.

No se si recordais aquel médico chino que murió con la piel negra. Sería un ejemplo de cómo se deposita en la piel.

 

El hierro también se absorbe a nivel del duodeno y principios del yeyuno. Lo hace a través de la proteína transportadora DMT 1, común para otros metales como el zinc y el cobre, vía también válida para el cadmio.

Establece una especie de competencia con este metal. Se ha observado en estudios que los pacientes con anemia por déficit de hierro son más vulnerables a la absorción de cadmio. Las mujeres suelen ser mas propensas a este tipo de anemia por las pérdidas menstruales y los síntomas suelen pasar inadvertidos. Los ancianos también son un grupo de riesgo al respecto.

La proteína transportadora DMT1 agravaría el cuadro por la entrada de mas cadmio por la vía digestiva. Para que el cadmio o cualquier metal pesado atraviese los alvéolos pulmonares y llegue a la sangre, ha de tener menos de 1 nm, tal y como asegura esta publicación.

http://www3.uah.es/bioquimica/Tejedor/bioquimica_ambiental/T3.htm

La entrada pulmonar masiva, deja en la faringe (órgano común del sistema respiratorio y digestivo) las nanopartículas que serían deglutidas y a su paso por el estómago, pasarían a formas mas fáciles de absorción.

La proteína transportadora DMT 1 tiene un análogo en los macrófagos y los neutrófilos, DMT1 o proteína 1 del macrófago asociada a resistencia natural 1 (Nramp1). Esto explicaría el daño a nivel de otros órganos que también poseen macrófagos del sistema retículo endotelial como las células de Kupffer del hígado, (esto explica el aumento de las transaminasas), células mesangiales (riñón),  las células de Langerhans de la epidermis, los osteoclastos del tejido óseo, la microglía del SNC, los macrófagos  del bazo o de las serosas pleural y peritoneal, o sea, todo un fallo multiorgánico que llevaría a la muerte.

Este vídeo de Josep Maria Subirá, enfermero Especialista en Medicina del Trabajo y Salud Laboral sobre el cadmio nos explica cómo nos intoxica el cadmio.

Una de las cosas que mas me refuerza en que el agente causal sea el cadmio son las secuelas que se están describiendo.
https://www.eldiario.es/sociedad/secuelas-covid-19-cara-visible-pandemia_1_6049951.html

Tendremos fibrosis pulmonar, lesiones renales, cardíacas, trombosis, disgeusia y anosmia (pérdida del olfato y el gusto), entre otras.

Este último síntoma puede estar causado por el déficit de zinc pero también por cadmio.

Como mencionamos, la proteína transportadora DMT1 también transporta zinc. En la intoxicación por cadmio este es uno de los tratamientos usados precisamente por esta condición: vitamina C + zinc, así que ya sabéis que hacer.

Gisbert- Calabuig

Curiosamente se les indicó a los médicos esta deficiencia de zinc en los pacientes con Covid19.

Y resulta todavía más curioso como los masones se avisaban ya a principio de abril sobre tomar zinc, vitamina C y otras substancias.

La intoxicación por cadmio por vía digestiva fue descrita por primera vez en 1912 en Japón, lugar en el que hubo exposiciones a este metal de forma crónica por el vertido del mismo en el río Jitsu.

La enfermedad itai-itai es, junto a los envenenamientos por metilmercurio de Minamata y Niigata-Minamata, y el asma por contaminación atmosférica de Yokkaichi, uno de los cuatro grandes desastres sanitarios ocurridos en Japón por causa de la contaminación.

Se llama enfermedad itai-itai a una dolencia ósea debida a la intoxicación por cadmio. Se caracteriza por múltiples fracturas, alteraciones combinadas con osteoporosis y osteomalacia, daño renal, enfisema y anemia. ¿Me pregunto cuántas mujeres no han sido diagnosticadas erróneamente de osteoporosis siendo esta la causa o en cuántos abuelos habrá pasado inadvertido por la artrosis y fracturas achacadas a la edad?

Se observó una marcada prevalencia en mujeres posmenopáusicas mayores en las que provoca dolores violentos en la pelvis y miembros inferiores.

Hubo una mayor prevalencia en personas mayores malnutridas y en mujeres embarazadas o en lactancia. ​El agua, cargada de cadmio, zinc, cobre y plomo, se usa para inundar los arrozales. El arroz es capaz de bio concentrar el cadmio, hasta 3 veces más que el contenido del agua. El suelo tenía unos niveles de 1,1 ppm, frente a 0,3 ppm de los suelos no contaminados.

Os recomiendo este artículo si queréis saber más sobre estos envenenamientos criminales.
https://www.nippon.com/es/currents/d00383/

En este caso la vía digestiva fue utilizada pero también hay otro hecho que se encuentra relacionado con la geoingeniería. Es el caso de la Operación Lac.

La Us Army Chemical Corps realizó la Operación LAC (Largue Area Coverage), la cual consistió en fumigar extensas zonas de Estados Unidos con Sulfato de cadmio de Zinc (ZnCdS).

La operación LAC, no fue otra cosa que un experimento químico, efectuado por el gobierno estadounidense para determinar qué efectos produciría en la población, la dispersión de sustancias nocivas para ésta.

Se eligió fumigar a la población con sulfato de cadmio de zinc, porque su tamaño (2-3 micras), era muy similar al tamaño y la masa de las partículas de los agentes biológicos de uso militar, además de ser un producto relativamente fácil y barato de fabricar y de poder ser visto con facilidad con una luz ultravioleta.

Este producto no es soluble en el agua, por lo cual se consideró que no afectaría a plantas ni animales (hombres incluidos).
Os dejo enlace
https://blogs.elcorreo.com/jorbasmar/2013/07/16/operacion-lac/

Fue precisamente la presencia de nieblas muy densas en esos días del comienzo de la #tragipandemia lo que le hizo sospechar a Tec sobre un posible tóxico que pudiera entrar por esta vía. Al comentarmelo, busqué un metal que provocará todo esto hasta llegar al cadmio. Este es el resumen que os puedo ofrecer.

En cuanto a la forma de entrada por todo lo que os he explicado de síntomas respiratorios similares a la gripe no me queda duda de que hubo una exposición de los pacientes al cadmio por esta vía, que incluso cuadros de supuesta gripe o bronquitis fueran por su inhalación, pero no os asustéis, la gravedad sólo es válida para un grupo reducido que al ser mas vulnerable reaccionó de esta manera.

En cuanto al polisorbato 80 presente en las vacunas, no me parece descabellado como forma de entrada, pero más para predisposición. Se trata de un emulgente, o sea que disuelve grasas. Podría ser que el mismo compuesto facilitara la rotura de la membrana celular que posee una estructura de lípidos y glicoproteínas e incluso que en el tejido adiposo formará una especie de cápsula liberadora de metales pesados. Como estamos con el cadmio como agente productor, tengo que decir que en las vacunas de la gripe no viene reportado.

Posiblemente hablemos de los componentes “extra” contenidos en las vacunas en un algún futuro artículo desvelando que como se cita en algunos estudios contienen nanopartículas metálicas muy posiblemente debido a la geoingeniería.

Sin embargo en la vacuna del Papiloma humano, hubo una condena por encontrar dicho metal en un análisis de los componentes que realizó una demandante a la que se le había provocado un daño, precisamente por no  reportar los fabricantes su presencia.

Me despido con una noticia que hace pensar. Se trata de la huella con la que podremos identificar este periodo de “confinamiento” en el futuro. Los casquetes polares albergarían trazas de aerosoles, si, de cadmio. ¿Cómo es posible?🤔

Espero que podáis asimilar todo esto y que os lo haya puesto fácil de comprensión. Se que es complicado pero necesario para llegar a la verdad.

Un abrazo y feliz día.

 

Bibliografía

– Gilbert/ Calabuig Toxicología

Otros enlaces de interés

– Artículo que explica la función proapoptoica de la mitocondria.

https://www.elsevier.es/es-revista-offarm-4-articulo-la-mitocondria-como-diana-farmacologica-13041301

– Efectos genotóxicos del cadmio y otros metales

https://drive.google.com/file/d/1VsxmST6YxrYcqCU0c7Nn36dwPxvrjk0X/view?usp=drivesdk

– Cadmio neurotóxico

https://drive.google.com/file/d/1VnBNxQd19hLC2CWj8HjA1mAukgAQyYoX/view?usp=drivesdk

– Interferencia inmunológica entre el POLISORBATO 80 de la vacuna antigripal adyuvada y el SARS-CoV-2

– La fábula de los animales con el virus de la corona

https://t.co/qc63iYlQD9?amp=1

https://t.co/qc63iYlQD9?amp=1


Legal disclaimer  

 

Redescubriendo el UniVERSO de los números maestros

 

Os voy a contar algo que por casualidad he encontrado. Como ya habréis comprendido a éstas alturas, poco conocemos de este mundo y sus verdaderas ciencias. En esta ocasión vamos a tratar sobre algo que ya conocemos , la Circunferencia, pero de otra manera. Así que, adelante!!!

La Circunferencia es una línea curva, cerrada y plana, cuyos puntos están todos a la misma distancia de otro punto, llamado centro (Radio). El Plano es la representación de algo en 2 dimensiones por lo que usamos las coordenadas (ejes de abscisas y ordenadas).

Podríamos por tanto, en el caso de la circunferencia dividirla en 4 a partir del radio, por lo que quedarían los ejes en forma de Cruz con un centro en su caso.

 

Mi inquietud era descifrar alguna relación con el número 33, número que veo insistentemente. Sabéis que me gusta la astrología y observé que siempre se divide en 12 signos la circunferencia zodiacal.

Pero había un problema, si la circunferencia tiene 360°, los ángulos que se forman al dividirla en 12 partes iguales serían de 30°, que no 33°.

Este sistema conocido por todos se denomina Sistema Sexagesimal y durante la investigación que estoy llevando a cabo con los Médici, al llegar a Sumeria, encontré que era el sistema usado por sus pobladores, razón por la que como venimos viendo sería una explicación de hasta dónde se remontan nuestras costumbres.

Este sistema se basa en el número 60. Es la razón por la que la circunferencia tiene 360°. Si dividimos en 4 como he dicho anteriormente a la circunferencia, tendremos 4 ángulos rectos o de 90°, que sumados dan 360°. Este sistema se usa sobre todo como medida de tiempo: 1 hora = 60 minutos, 1 minuto = 60 segundos, etc.

Pero hay más sistemas para medir los ángulos en el Sistema Internacional (SI).

No sólo existiría este sistema sexagesimal, también hay otro aceptado y que tengo que confesar que al menos yo desconocía.

Se trata del Sistema Centesimal.

Como su nombre indica, utiliza el número 100 como base.

El sistema centesimal divide una circunferencia en 400 partes iguales, o bien, un ángulo recto en 100 partes iguales, y a cada una de esas partes se le denomina grado centesimal o gradián, y se simboliza con una “g” minúscula como superíndice del número, como por ejemplo 35g.

 

La relación del radián con la otra unidad de medida para ángulos más ampliamente utilizada, los grados sexagesimales o simplemente grados (º), es la siguiente:

1 vuelta completa de la circunferencia  =  360º

=  2 · π   radianes como base.

Siguiendo la lógica anterior en un plano, nuestra circunferencia, con este sistema, quedaría dividida en 4 partes de 100 y la suma de los ángulos sería de 400° y no 360°.

Un radián es la unidad de medida de un ángulo con vértice en el centro de una circunferencia y cuyos lados delimitan un arco de circunferencia que tiene la misma longitud que el radio.

El radián (rad) es la unidad de medida para ángulos en el Sistema Internacional de Unidades (S.I.).

 

No os quiero agobiar con esta explicación, por lo que os dejo el link para que sepáis de donde sale el número 400.

https://ingemecanica.com/tutoriales/sistemas_de_medida_de_angulos.html

Así que pasemos a lo “gordo”.

Si usamos por tanto el Sistema Centesimal de 400° para la circunferencia en Astrología y dividimos en 12 partes iguales (signos del Zodiaco) nos saldría este bonito y persistente número:

 

Dividiendo entre 6 tendríamos:

 

Aunque este sería el número maestro 66, fijaos que la cifra es de 9 números y que en la posición 9 hay un 7,el número de la perfección o de lo divino según la numerología.

Esto se produce porque las calculadoras mas sencillas usan 9 cifras, y el 7 en esa posición es una aproximación, en realidad se trata de un número periódico. Ahora, éste detalle (error inicial por mi parte) me hizo fijarme en el número 9, lo que será importante mas adelante. Dios utiliza muchos caminos😉

Observemos qué pasa con el resto hasta 12.

Las divisiones que nos dan números decimales son con 3, 6, 7, 9 y 11.

400 : 2 = 200

400 : 3 = 133, 333333 (se repite el 33 cuatro veces)

400 : 4 = 100

400 : 5 = 80

En 6 ya lo vimos, nuestro 6,66666667

400 : 7 = 57,1428571 ( se repite 571)

400 : 8 = 50

400 : 9 = 44, 4444444

400 : 10 = 40

400 : 11 = 36, 3636364 (se repite el 36 cuatro veces y termina en éste, o sea 4).

Y en el 12 nuestro 33, 3333333.

De éstas divisiones hasta el 12, obtenemos los números maestros 33, 66 y 44 que se relacionan con las divisiones por 6, 9 y 12.

Pero hay algo más.

El número 9 destaca por ser constante número de cifras como os comentaba por mi error al no tener en cuenta la aproximación de la calculadora, así que analicé las divisiones del número 400 entre múltiplos de 9 y observé que estaban presentes casi todos los números maestros excepto en los derivados de la multiplicación del 9 con el 3, 6, 7, 9 y 11 de nuevo, que son el 27, 54, 63, 81 y 99 respectivamente.

Por ejemplo:

9 x 1 = 9,    400 : 9 = 44,4444444

9 x 2 = 18, 400 : 18 = 22,2222222

9 x 4 = 36, 400 : 36 = 11,1111111

9 x 5 = 45, 400 : 45 = 8,88888889, el 9 en novena posición.

9 x 8 = 72   400 : 72 = 5,55555556, el 6 en novena posición.

9 x10 = 90 400 : 90 = 4,44444444

Hasta aquí tenemos todos los números maestros excepto el 77 y el 99. Algo pasa con los números 3, 6, 9 que decía Tesla aunque yo añadiría al 7 y 11 para ser justos en ésta serie.

Que pasa con los números resultados de la multiplicación del 9 por 3, 6, 7, 9 y 11?

9 x 3 = 27, 400 : 27 = 14,8148148 ( se repite 3 veces el 148).

9 x 6 = 54, 400 : 54 = 7,40740741 ( se repite 74 o termina en 740+ 1)

9 x 7 = 63 400 : 63 = 6,34920635 ( se repite el 63 o termina en 634+1)

9 x 9 = 81 400 : 81 = 4,9382716049382

(Se repite el 4,9382).

9 x 11 = 99, 400 : 99 = 4,04040404 ( se repite el 4 o 04 cuatro veces)

Otras curiosidades en los resultados.

9 x 11 = 99, 400 : 99 = 4,04040404 (se repite el 40)

9 x 12 = 108, 400 : 108 = 3,7037037 (se repite el 37 o 370)

9 x 13 = 117, 400 : 117 = 3,41880342 ( 3,418 ~3, 42 y termina en 342 o 341 + 1)

9 x 14 = 126, 400 : 126 = 3,17460317 (se repite el 317)

9 x 15 = 135, 400 : 135 = 2,96296296 (se repite el 296)

A que estáis flipando!!!

A partir de aquí no hay números curiosos hasta 9 x 20 = 180, 400 : 180 = 2,22222222. Después salen más.Si me equivoco en algo, espero que me rectifiqueis. Ante tanto 9 (número del ego) no quisiera quedar atrapada.

En fin, que aquí os dejo está reflexión sabiendo que podría tratarse de una puerta a otras investigaciones. Espero les sea útil.

Hay cosas que no me explico como el por qué la circunferencia se tiene que dividir en 12, por qué el 12?

Se me ocurren posibilidades simbólicas como:

3 x 4 = 12 (la Trinidad+ la materialidad del 4 se unen) o :

9 + 3 = 12 (el ego más la Trinidad) etc.

Que estemos reproduciendo un reloj espacial: como es arriba es abajo, macrocosmos- microcosmos.

Así encontré una razón para un conocido símbolo que es el de la masonería:

user uploaded image

…siendo el compás el que traza la circunferencia del mundo en que vivimos, la escuadra como instrumento del mundo en sus dos dimensiones y la letra G de gradián, unidad que lo divide.

Posiblemente esta sea una capa menos de la cebolla que intenta descifrar una servidora y que comparte con vosotros. A la espera de vuestras observaciones.

Continuará…


Legal disclaimer  

 

Despertar no es lo que te contaron ¡Despierta!

Artículo colaborativo de Buscadores de la verdad iniciado por iabd redactado por UTP.

Resulta bien difícil poder explicar algo que ni uno mismo comprende bien y mucho más si para hacerlo debemos evitar al máximo el meternos en problemas. Por ello, aunque vamos a intentar mostrar lo que muchos todavía ni tan siquiera se imaginan, evitaremos en la medida de lo posible el dar nombres concretos y sobre todo nos alejaremos de esa guerra intestina que se está librando en las redes con acusaciones entre diferentes grupos de ser disidencia controlada de forma ya totalmente incontrolada.

Creo que ya es hora de abandonar la niñez conspiranoica y avanzar por fin a otro nivel de comprensión de lo que creemos está ocurriendo realmente. Eso que llamamos despertar consiste precisamente en eso, en empezar a ver lo que otros ni tan siquiera imaginan y aplicar en tu vida de forma consciente aquellas cosas que has ido aprehendiendo a lo largo de esa etapa.

Dicho todo esto, y como se que muchos de ustedes nos siguen a través de las redes sociales a mi y a otros buscadores de la verdad, les mostraré un gráfico de creación propia donde a grosso modo podemos ver un poco lo que se pretende explicar en este artículo y es que nada es lo que parece y que todos de un modo u otro participamos en llevar adelante ese tan manido Nuevo Orden Mundial.

Vemos un toroide con dos cuerpos principales, uno en color rojo representando a los covidianos y otro en color verde haciendo lo mismo con su antítesis los anticovidianos.

¿Pero qué son los covidianos? Yo mismo lo definí en este diccionario colaborativo en el que les invito a participar.

 

Un covidiano se cree o está directamente implicado en ejecutar la Tragipandemia que estamos padeciendo en estos momentos, esta pandemia creada ex profeso para maximizar el miedo y minimizar el problema epidémico real ya que se trata de dramatizar un evento epidemiológico convencional y llevarlo a ser el primer evento global destructor y constructor al mismo tiempo. Un 11S pero a una escala nunca vista antes.

Desde este blog han podido leer varios artículos junto a Enrique de Diego como Cuestionario de Enrique de Diego sobre las vacunas y la actualidad y No desesperen en la era del bozal. Pasará donde con todos los datos en la mano se explicaban las malvadas obras que algunos supuestos filántropos como Bill Gates quieren acometer con la humanidad. Ya saben, todo ese tema de la despoblación, de la vacunación sin motivo alguno, de la implementación de una vida cada vez más controlada llegando a estar ya en una vigilancia continua, en una #LIV o Libertad Individual Vigilada.

Toda esa parte roja la han ido conociendo gracias a gurús “verdes” como el señor Alex Jones de Infowars. En este video podemos ver la maniobra de control de daños por parte del propio sr Jones cuando se da cuenta de que uno de sus seguidores conoce muy bien de donde procede y porque está ahí.

No le quedó otro remedio que admitir que sí, que él procede de una larga dinastía de masones y de rosacruces. 

Lo que me resulta increíble es que después de estas declaraciones todavía siga siendo considerado un referente entre el mundo de la conspiración.

¿Dónde podríamos encajar al señor Jones en nuestro esquema de covidianos y anticovidianos? ¿Dónde podríamos situar a los innumerables grupos que componen la masonería o a los muchos de los rosacruces?

No deberíamos catalogar en espacios tridimensionales a ninguno de estos grupos, es más, pueden devenir en una u otra posición dependiendo de las circunstancias ya que lo que importa es tan solo que “esto se mueva“, que circule energía.

Veamos el discurso de John F. Kennedy Soy Berlinés pronunciado en Berlín en 1963.

Hace dos mil años, no existía mayor orgullo que decir “Civis Romanus sum” (“soy un ciudadano romano”). Hoy, en el mundo de la libertad, no hay mayor orgullo que poder decir “Ich bin ein Berliner!!” (¡¡Soy berlinés!!).

Si entendemos como equivocado el mundo civilizatorio que nos esconde las grandes maldades de la civilización (obscenario) y nos envuelve en papel de caramelo las supuestas bondades (escenario) nos daremos cuenta que el tan idolatrado Kennedy tan solo estaba representando un papel. Les contó a los berlineses lo que estos querían oir, que el comunismo era malo y que el capitalismo les traería todo lo que deseasen.

¿Dónde situamos ese discurso de JFK? ¿En la parte verde o en la roja?

Recientemente este 29-8-2020 en Berlín su sobrino ROBERT F.KENNEDY Jr. pronunció otro discurso histórico aprovechando una enorme concentración de personas en contra de esta locura colectiva que estamos viviendo.

Y les volvio a contar a estas personas exactamente lo que querían escuchar, que el capitalismo es malo y que un nuevo mundo global pseudocomunista será mejor.

Yo no me fiaría mucho de una familia que es capaz de realizarle una lobotomía a una pobre joven con problemas derivados de su nacimiento.

Estos dos polos tan supuestamente enfrentados vienen de lejos, de muy lejos. Por ejemplo no se si habrán oído hablar de las reducciones jesuitas en Hispanoamérica. Este video de Jorge Guerra lleva publicado en Youtube desde septiembre del 2016 pero dejaré una copia por si le da por desaparecer.

 

¿Dónde situamos a los jesuitas? ¿En la parte roja con el poder pasado y actual o en la parte verde con el poder emergente?

Todo se entiende mejor cuando conocemos por ejemplo que el confesor de Franco fue un jesuita, el padre Llanos.

El jesuita padre Llanos era el confesor espiritual del dictador Franco y fue clave en la fundación del Partido Comunista de España y del sindicato Comisiones Obreras. Su propósito, controlar al proletariado, a la denominada clase obrera. Detrás del PCE y de CCOO, de ESADE, Deusto, Complutense, Comillas, etc… es donde la Compañía de Jesús comenzó a cavar sus cimientos en el pueblo español; años antes de que se produjera la transición, en 1955, cuando el Padre Llanos “abondó” a Franco, al que le hacía los ejercicios espirituales y se unió a los comunistas junto con otros jesuitas. En realidad la Compañía tiene prohibido actuar sin la autorización del provincial, o en este caso del General Superior de los jesuitas, el poderoso Jean-Baptiste Janssens por aquel entonces, después Padre Arrupe.

Esta cita donde se dice textualmente que el padre Llanos estuvo involucrado en la fundación del Partido Comunista de España no puede ser cierta ya que el padre Llanos apenas acababa de entrar en el seminario. Está tomada del libro del cual muestro un extracto en la siguiente fotografía.

Extracto pág 72 del libro El camino de la concordia: de la cárcel al parlamento de Gabriel Elorriaga Fernández

Mi padre, que en paz descanse, se habría vuelto loco al siquiera sospechar como este cura que tan buena predica tenía entre los comunistas hubiera inspirado la creación de grupos de militares como “Forja” o hubiera sido confesor de Franco.

Para google este blog no es seguro…lo que sí es seguro es la buena información que contiene.

¿Comunistas y jesuitas? Mi pobre padre se hubiera muerto de un patatús de disonancia cognitiva.

Por eso se entiende perfectamente porque los archivos históricos del PCE (Partido comunista de España) se encuentren en manos de una universidad jesuita como la Complutense de Madrid.

Comparativa del cuadro “Visión de Don Bosco” (jesuita) y cuadro de logia masónica con el suelo ajedrezado.

Porque aqui no importan los colores, importa el intercambio de energía, el paso del negro al blanco y viceversa.

¿Recuerdan la primera imagen con ese toroide ajedrezado?

Pues miren cual es el símbolo de la Complutense. El ajedrezado es lo verdaderamente importante…es la parte central de toda esta historia, la bipolaridad de la energía manifestándose.

Por poner un ejemplo. ¿Los supuestos partidos de izquierdas como Podemos están en la parte roja o en la parte verde?

Fíjense que bien lucía la camiseta proscrita el señor Juan Carlos Monedero. Ese pedazo de Ouroboros sobre fondo lila que al ser desvelado su verdadero propósito por unos pocos fue dejada en el cajón del olvido.

El Ouroboros, el ajedrezado y la esvástica simbolizan en el fondo lo mismo. Nos indican que todo es una rueda que no para de moverse y que los que conocen y aprovechan estas energías son los que vienen dirigiendo el mundo desde las sombras.

La práctica totalidad de políticos de alto rango, como Rajoy o Zapatero entre otros, y de altos cargos de las finanzas y empresas han sido formados y educados en centros y/o universidades jesuitas.

Pero basta ya de hablar de los jesuitas. Esto no va de ellos…esto va de movilizar energía, de generar un enorme vórtice.

Por poner otro ejemplo, entenderíamos a la ONU como un elemento rojo que pretende instaurar un NWO (Nuevo Orden Mundial) preeminentemente satánico, ¿no?

La campaña de la ONU de “Todos juntos en casa” es desde luego bastante significativa de donde nos quieren meter. En casita y con la pata quebrada…je, je, je.

Campaña apoyada por gente tan absolutamente desquiciada como Lady gaga. El adjetivo gaga se otorga a los ancianos que pierden la capacidad del habla pareciendo volver a la edad cuando eran bebes y solo sabían decir “ga ga ga”.

¡Bonita cruz invertida roja y ojo de Horus!

Evidentemente el nombre artístico de esta señorita esconde una vez más el movimiento eterno de la energía que no se puede crear ni destruir. Digamos que se trataría de una covidiana roja, ¿verdad? 

De la cuna a la tumba, ¿se acuerdan?

Bueno. Prosigamos.

En el otro lado del toroide supuestamente tendríamos a los anticovidianos como el médico italiano Pasquale Bacco. Médico que ni más ni menos que se atrevió a desafiar a la OMS practicando las primeras autopsias a los cadáveres que supuestamente habían muerto por Covid19. Gracias a esto se descubrió que el protocolo de tratamiento que ordenaba la OMS era contraproducente y que con otro tratamiento se salvarían más vidas.

¿Todo un héroe verde, verdad?

Veamos una entrevista realizada en el canal tertulias liberales con el sugerente nombre de:

LA MUERTE QUE DA LA VIDA

LAS AUTOPSIAS ITALIANAS QUE CAMBIARON LA HISTORIA

(Notese la enorme casualidad de los colores de la bandera italiana)

Si no quieren escuchar toda la entrevista les dejo por aqui los 4 minutos más importantes donde nos cuentan que es El Herético (una comunidad internacional llamada el hereje) y cómo ven ellos el nuevo mundo, la nueva normalidad que desean para toda la humanidad.

Y aún más comprimido en tan solo ¡33 segundos!

Estaba explicandole Fernando al doctor que nosotros somos, esto, un grupo que queremos hacer, eh, todo el mundo un único pais donde no haya estas barreras que siempre nos han contado de dividirnos ¿no? Y, eh, por eso es que llevamos este testimonio desde diversas partes del mundo porque cada pais vive a su modo ¿no? Es importante recalcar esto. Pero estamos, este, derribando estas barreras y uniendo. Tendiendo puentes

Sí, escucharon bien, un único mundo para todos…un NWO pero en verde, en bonito, en el lado correcto.

Como dije antes, el título de la muerte que da la vida, vuelve a sugerir ese movimiento infinito de la energía que vuelve a surgir de sus cenizas como el ave Fénix.

Otro animal que refleja perfectamente ese simbolismo de movimiento perpetuo es la serpiente enrollada, no por nada el símbolo de los liberales es dicha serpiente.

¡No me pises!

Lo tiene todo, los tres seises, la energía comprimida en forma de muelle y por supuesto el ajedrezado. Como podemos leer en Símbolos, mitos y arquetipos:

La espiral simboliza desarrollo, extensión, rotación y progreso. La espiral nos muestra el carácter cíclico de la evolución donde los ritmos se van repitiendo mientras plantas y animales van creciendo de acuerdo a dichos ciclos.

La espiral viene a simbolizar en definitiva ese antiguo ajedrezado donde unos son blancos y los otros negros.

En el Museo Dalí de Figueras, encontramos otra obra de Dalí relacionada con la espiral. En un rincón del pasillo del último piso, es donde encontramos el dibujo en tinta china realizado sobre una fotografía de albumina de un fragmento de la columna romana de Trajano. Encima de dicha fotografía el maestro catalán dibujo una magnífica espiral que va ascendiendo mientras un hombre y un diablo están jugando al juego infantil de saltar el potro.

En el juego original de saltar el potro los dos participantes se van alternando en saltar uno encima del otro. Pero en esta ocasión el pintor ampurdanés nos muestra una versión que carece de dualidad, ya que el que salta siempre es el mismo y no es otro que el diablo. La visión dual de Dalí queda manifiesta en las dos pequeñas columnas que acompañan a la escena principal. Una columna está formada por una foto recortada de un hombre desnudo, mientras que la otra se forma a partir de una espiral dibujada a tinta desde cuya base se inicia el juego. Un juego donde el mal pasa por encima del hombre de forma alegre y sin pausa mientras vamos ascendiendo en la jodida espiral de la vida.

Ni que decir tiene que Dalí fue uno de esos altos iniciados que ponen en movimiento esta energía.

Los “de a pie” nos limitamos a seguirles el juego a estos grandes genios en cualquiera de los campos que les proporcionan visibilidad y les ayudan a perpetuar el eterno movimiento de energía.

Estos héroes han existido en todas las épocas y han dejado mitos para la historia como los doce trabajos de Heracles o Hércules si vds prefieren la nomenclatura moderna.

Hércules luchando con la hydra. François Joseph Bosio (1824). Louvre, Paris, France.

¿Podríamos considerar a Hércules disidencia controlada “por los dioses” para controlar valga la redundancia a los hombres? ¿Sería por tanto la primera disidencia controlada?

No voy a entrar siquiera a contestar estas preguntas porque lo que me interesa es que comprendan que ambos lados del toroide están implicados en la ejecución de lo mismo. En la instauración de un nuevo orden mundial andrógino que complete la serie matriarcado-patriarcado-androginarcado.

Desgraciadamente estas ideas provienen de satanistas como Alesteir Crowley y su religión Thelema con la teoría de los Aeones o eras.

El primero de estos fue el “Eón de Isis”, el cual creen los thelemitas que ocurrió durante la prehistoria y que observó a la humanidad adorar una Gran Diosa, simbolizada por la deidad egipcia antigua Isis. En las creencia thelemitas, le sucedió el “Eón de Osiris”, un periodo que tuvo lugar en los siglos clásicos y medievales, cuando la humanidad rendía culto a un solo dios masculino, simbolizado por el dios egipcio Osiris, y en consecuencia fue dominado por valores patriarcales. Finalmente el tercer eón, “Eón de Horus”, que fue controlado por una deidad infante, simbolizada por Horus. En este nuevo eón, los thelemitas creían que la humanidad entraría a un tiempo de autorrealización y auto actualización

Toda esa maldad que percibimos del lado rojo, del lado que parece detentar el poder absoluto en la actualidad no nos deja siquiera entrever la misma maldad en el lado verde, antagonista del lado rojo, que percibimos como bueno y necesario.

¿Es buena la transición energética que cambie el mundo como nos muestra el recién publicado “el nuevo orden verde“?

¡Por supuesto que sí! -contestaremos.

Lo que muy pocos sabrán es que las mismas familias de poder-religión que detentaban el poder energético con aquellas malisimas energías contaminantes son las que ahora son dueñas de las nuevas energías “limpias”.

Nos puede explotar la cabeza al entender que la más importante fabrica de obleas solares (núcleo técnico de cualquier panel fotovoltaico) que tuvimos en España, Silicio Solar

…pertenece a una subsidiaria de la empresa de la energía nuclear rusa, a través de la rusa JSC Rosatom.

Pero esto no solo ocurre en Rusia, o solo con algunas familias poderosas como los Rockefeller que ya hace tiempo dieron el salto a las energías renovables.

¿Habrán pasado de rojo a verde los Rockefeller?

No, ellos simplemente saben que el verde está de moda y hay que subirse al barco antes de que zarpe. Los demás iremos nadando, y eso el que sepa nadar.

Simplemente lo verde, lo correcto, dará más dinero.

No por nada el Sol es también uno de los símbolos de fecundidad, prosperidad y movimiento. Ya he explicado en otros artículos como TODAS LAS SUPUESTAS FACCIONES rinden culto al Sol.

Las ruedas solares son parte fundamental de este teatrillo que se viene interpretando por milenios y al igual que el ajedrezado son parte fundamental de la simbología en muchas religiones y cultos religiosos, por eso está en la plaza de san Marcos en el vaticano.

Organizaciones tan importantes como El club de Budapest” del que la Wikipedia apenas nos cuenta nada también emplean el símbolo de las manos con el disco solar o la tierra para recordarnos que es la energía lo que mueve el mundo.

Goi=goy=goyim bajo una estrella de 5 puntas invertida. New Age satanista en estado puro. Ecumenismo y paganismo

En este hilo de Twitter iabd nos contaba un poco más sobre lo que verdaderamente es dicho club.

Y es que parece que las pretensiones del fundador Ervin László de este club de Budapest que deriva de otro más antiguo, el club de Roma, son la antesala del Nuevo Orden Mundial…pero un NWO verde.

László expresó en su libro “Usted puede cambiar el mundo” que no hay opción para la próxima crisis mundial, lo que podría venir en forma de un colapso global centrado en la fragmentación creciente de la desigualdad económica y una nueva carrera de armamentos entre las potencias emergentes. La otra opción sería un gran avance global liderada por las organizaciones internacionales. Esto sería por la vinculación de las organizaciones no gubernamentales que promueven el desarrollo sostenible, utilizando la Internet. Su teoría llamada Macroshift se define como un movimiento popular que cambiará el rumbo de una crisis mundial a un avance global(el Nuevo Orden Mundial). László ve los años 2012-2020 como un período crítico para cambiar el curso de la crisis que viene.

Este señor te dice que puedes cambiar el mundo pero que no tienes opción de hacerlo ante la crisis que viene, bueno, ante la crisis que ya está aqui.

Una de tantas organizaciones cercanas a este pulpo del que forma parte el Club Budapest es “Humanity’s Team” creado por el autor espiritual Neale Donald Walsch, en respuesta a la crisis que vio enfrentar a la raza humana a partir de los hechos ocurridos 11 de Septiembre de 2001.”

Neal Donald Walsch es escritor, conferencista y mentor de millones de personas alrededor del mundo, autor de los nueve libros de la serie “Conversaciones con Dios”…un angelito vaya.

¿Y cuales son las enseñanzas de este venerable anciano?

 

En realidad estamos creando a dios a través del proceso de ser dios. Tal como nosotros elegimos crearlo.

Sé divinidad.

Desconfien profundamente de quien les diga que vds son superhéroes, dioses o están bendecidos por extraterrestes. Fijense en el logo de la empresa MindValley que nos vende ese video con sus ojos alien.

Miembros honorarios del Club Budapest, lo mejorcito de cada casa.

Una de las cosas que hacen es el “Global Oneness Day” (Día de la Unidad Global).

¡Todo, muy guay, muy zen, muy nueva era, muy verde vaya!

¡No se olviden de sonreir eh!

Como dice Angel cazachamucos (caza demonios) en su artículo La Nueva Era: EL CLUB de BUDAPEST y el 2012, toda una conspiración para el NOM

Se atrae mejor a las moscas con la miel que con el vinagre. Para conseguir el poder hay que mostrar una cara amable e inofensiva. Las armas son un método rústico y primitivo, pero además es que cuando lo que se pretende es un control global, y esa es la palabra clave en la new age, las armas crean división y polarización, cuando lo que se busca es la unidad para que el gobierno pueda ser global. 

El control mental es la clave, y conseguir “despolarizar”. Eso se intenta conseguir creando problemas globales, que requieren soluciones globales, léase por ejemplo calentamiento global.

Las armas ya vendrán después, para los rebeldes…

El sistema será “eco-social”, da igual en quien usted haya votado, la economía será “eco-social”. 

Claro, no van a decir eco-fascista, o fascista a secas, quedaría feo. 

Pero en realidad es fascista, totalitario, porque nadie ha votado sobre ese asunto, está diseñado por iluminados newagers y multinacionales.

 

Creo que no hace falta que les comente que los nuevos gurús anti covidianos al igual que los antiguos héroes clásicos están pero bien metidos en temas New Age, yoga, meditación, contactismo, despertar la kundalini y demás cosas guays.

Convocada el día 16 a las 19 la manifestación de Madrid fue y sigue siendo utilizada para ridiculizar al lado verde. Negacionistas…bonito palabro se han inventado los periodistas colaboracionistas del #periodismo_que_calla

Un bonito reflejo de pirámide truncada. Las personas convocadas no conocen a las que convocan. Escenario y #obscenario

¿Cuencos tibetanos, ritmos de tambor para atraer qué? Agua y reflejos.

¿Y qué decir del lugar donde se convocó la concentración #Madrid16A ? El ojo que todo lo ve vigilando desde arriba que los “indignados” sigán el compás… Vía @VeilIsis

Todo muy Nueva era, muy espiritual, para gente “despierta” o en proceso de despertar.

El método de la Nueva Era, es la guerra psicológica, que también es fundamental en las guerras convencionales modernas. No recuerdo quien decía que la mejor dictadura es la que los gobernados piensan que están haciendo lo que ellos quieren. Aquí se trata de eso, de lavar el cerebro a la gente, y que luchen por unos objetivos diseñados por estos think tanks newagers. Esa es la manera de conseguir los objetivos. 

 

El mundo está a punto de cambiar hacia el verde. ¿No quieres ir a la moda?

Por cierto, grupos como Global Oneness Day son “Un movimiento espiritual global centrado en despertar“, “creado tras una visita a la ONU”.

¿Se acuerdan cuando en mis primeros podcast se escuchaba la palabra GAIA con una sonrisa? ¿Llegaron a escuchar mi comentario de porque elimine esa palabra de la cabecera de mis podcast sobre ecologia, ciencia y energia que empece en Canal Zero?

Resulta que al parecer no era exactamente lo que yo creia. Y es que cuando empiezas a despertar lo normal es tropezar con alguna de las miles de webs, fundaciones, videos de Youtube o artículos que parten de este tipo de grupos. Muchísima gente distribuye y amplifica este tipo de información gratis y de motu propio porque realmente creen que es lo mejor, que es lo correcto, creen estar en el lado bueno del toroide.

Pero no se dan cuenta que el dinero que mueve el mundo no tiene color. Para “hacer dinero” solo hay que tener una buena estrella de 5 puntas invertida y a poder ser ajedrezada.

Un Rockefeller financiando la “Foundation for Conscious Evolution” de Barbara Marx Hubbard.

Literalmente juegan con nosotros y no crean que lo digo en sentido figurado.

De casta le viene al FILÁNTROPO. El padre de Bárbara Marx Hubbard fue el dueño de la compañía de juguetes más importante del mundo en la década de los 50, la Louis Marx and Company. Que mejor signo de suerte que un trébol de cuatro hojas.

Menos mal que era un “recaudador de impuestos” agnóstico. Auténticos “SEÑORITOS DE LA LUZ” de familias BIEN SITUADAS.

Bárbara hace buenas migas con otro que también viene de casta, Foster Gamble.

Foster Gamble es descendiente del fundador de la multinacional “Procter & Gamble”. Se ha autodenominado embajador planetario, supongo que para cuando vengan los ET estar ya en la línea de salida.

Es prácticamente imposible que no tenga vd algún producto de esta multinacional en su casa, aqui tienen algunas de sus marcas más conocidas.

Y por supuesto volvemos a tener al Sol como fuente de energía y prosperidad…con sus 13 estrellas y sus rizos en forma de 666.

Foster mando hacer el documental “Thrive”, donde también participó Bárbara (acompañada de otros cuantos de la camarilla nueva era).

¡Quítate la venda, pero poco, que con un ojo tienes bastante!

¿Quieren una lista de disidencia controlada? Simplemente vean los créditos de esta película.

Ya les decía el otro día que pensasen por vds mismos…y tuve que retirar mi tuit porque tuvo más de 400 RT en solo un día.

El lado verde vio la oportunidad de promocionarse a través de un servidor.

La llamada era de acuario inaugurada en 2012 nos ha traído mucho “iluminado” vendiendonos la paz mundial, la conciencia mundial, la chorrada guay que vds quieran pero mundial.

Este es el último episodio del documental de Keith Thomson Acuario la Nueva Era del Mal 13 – La Elite contra la Profecía Bíblica pero les recomiendo ver la serie entera antes de que Youtube la retire. (Y eso que estaba ahí desde 2011)

Estamos en un punto de inflexión donde esos pobres verdes oprimidos que sólo quieren hacer cosas buenas por la humanidad tomarán la delantera ante todo pronóstico.

No se como lo harán, si será con efectos especiales blue beam y cielos repletos de avistamientos ovni o si el hartazgo ante estas medidas terriblemente injustas de bozales, confinamientos y represión callejera derive en un masivo despertar de la población. Pero recuerden lo que nos decía Ángel cazachamucos.

También hay otros métodos, como provocar las situaciones de crisis necesarias para que puedan producirse los cambios, sin crisis no hay cambios.

Esta guerra es psicológica. Se verá a gente manifestándose pro-activamente por un cambio climático, pidiendo que se tomen medidas en las diversas crisis, y cuando se lleven a cabo los muy infelices pensarán: ¡LO HEMOS LOGRADO!


… “Para dominar el mundo no se requieren sistemas sofisticados de control mental sino abrir la jaula de los instintos más básicos”.

 

Tan solo hemos entrado al agujero de conejo, ni siquiera hemos escarbado. Espero que iabd nos muestre ese macro esquema con todas esas increíbles ramificaciones…pero de momento ya saben, sean felices y cuiden de sus familias.


FUENTES:

La Nueva Era: EL CLUB de BUDAPEST y el 2012, toda una conspiración para el NOM

CLUB DE BUDAPEST: MUNDIALISTAS NEW AGE

Traducción de uno de los capítulos de documentación por Andy Robbins, y publicado en su pagina: http://www.envisionism.com/research/topics.html

http://www.manitou.org/MI/mhcp.php

http://antipachamamistasenaccion.blogspot.com/2007/05/breve-historia-de-la-secta-new-age.html


Legal disclaimer  

 

La COVID1984 como NEO RELIGIÓN ESTATAL a sumarse a los cultos previos (Calentología, Culto Lila, LGTBismo, VIHismo…)

Un ensayo de AYN RANDiano2

Ensayo: La COVID1984 como NEO RELIGIÓN ESTATAL a sumarse a los cultos previos (Calentología, Culto Lila, LGTBismo, VIHismo…)


DISCLAIMER: Hilo de cogitaciones personalísimas. No doy consejos médicos. Consulten siempre las directrices oficiales plandémicas del momento (ya que cambian de contínuo) y tomen sus propias decisiones en temas médicos a la luz del máximo de evidencia científica posible (que muchas veces NO coincide con la narrativa oficial)

En mi evaluación la COVID1984 es un REVIVAL RELIGIOSO del TimoSIDA de los 80, que ha ido “decayendo” hasta convertirse en una Fe Muerta en la que en realidad casi nadie cree, y que es por lo tanto inútil ya a efectos de control social.

IMHO, la COVID1984 es un revestimiento con nuevos ropajes del TimoSIDA, lo mismo que el TimoSIDA fue un revestimiento con nuevos ropajes del TimoSífilis:

El “VIH/SIDA” es una “SÍFILIS II” o “Sífilis, Segunda Parte” (Autopsia de un viejo FRAUDE MÉDICO, la

Escribí un hilo sobre religiones estatales:

Sociedad: – Ensayo sobre los CULTOS RELIGIOSOS CREADOS POR EL ESTADO: Desde la Grecia Clásica hasta la España de

Al panteón previo de Dioses Estatales a adorar (al estilo de los diferentes dioses de la religión estatal del Imperio Romano) se nos ha sumado un nuevo dios: La Covid1984.

No es nada nuevo, en el panteón ya teníamos un dios previo ya semi olvidado, el “VIH”:

Sociedad: – Paralelismos entré YHVH y el “VIH”. El “Virus del SIDA” como el Dios de la sociedad actual

La histeria Covidiana de 2020 tiene un precedente en la histeria del SIDA en los años 90, a modo de ejemplo:

Años 80 “VIH”: Sexo = Muerte


2020 Covid1984: Relaciones sociales = Muerte


El mensaje y la narrativa de los anuncios de la Iglesia Covidiana 2020 es idéntico a los de la Iglesia del SIDA de los años 1980. Por supuesto que ni las relaciones sexuales mataban de verdad en los 80 (de hecho la “epidemia del SIDA” no comenzó a despegar hasta 1987, con la introducción del AZT) ni las relaciones sociales matan en 2020. Son todo campañas de terror hipnótico de masas, como explicó el disidente del SIDA John Rappoport.​
En realidad la Iglesia del Covid1984 es un REVIVAL de la Iglesia del “VIH/SIDA”, que estuvo vivísima en los años 80 (es necesario haber vivido el terror del SIDA en los 80 para saber esto) pero que en 2020 ha degenerado ya en una FE MUERTA. Los únicos que nos tomábamos en serio el TimoSIDA en 2020 éramos los disidentes del SIDA y los Ultraortodoxos de la Secta VIH, y ambos grupos somos 4 gatos. El TimoSIDA no preocupaba ya a casi nadie. Creo que por eso han “relanzado” el TimoSIDA pero con nuevos ropajes COVIDicos: Ahora es “otro virus” que causa “otra enfermedad”. El envoltorio es diferente, pero el producto es exactamente el mismo:
Los que vivimos la histeria del SIDA en los 80 (la época de esplendor de la neoreligión “VIH”) estamos teniendo muchos deja vu en este 2020: Ya vimos en los 80 lo que estamos viendo en 2020.​
Ejemplos de deja vu TimoSIDA-COVID1984:​
la Mascarilla ocupando en 2020 el lugar del Condón en los 80:​
El artilugio mecánico que nos va a “salvar”. El ritual apotropáico de “ponerse la protección” como explicó el disidente del SIDA John Lauritsen:​
La aparición por sorpresa de los “asintomáticos”, que desmentian toda la narrativa anterior sobre el “mortal virus”.​
Esto ya lo vimos en 1985 al aparecer el “test de VIH” y los primeros “VIH+” perfectamente sanos. En el COVID1984 nos causó risa en abril que nos informasen de que la mayoría de los “infectados” del Diamond Princess eran “asintomáticos”. Iba en contra de toda la narrativa anterior sobre el “letal virus” que la mayor parte de los “infectados” fuesen “asintomáticos”. De inmediato los “asintomáticos” fueron aceptados como algo sabido de toda la vida, pese a darse de tortas con toda la increíble narrativa oficial hasta ese momento que presentaba a la COVID1984 como una especie de Ébola de transmisión aérea.​
El incremento de los dos primeros sintomas iniciales del “síndrome” a una lista cómicamente larga de enfermedades inverosímiles que nada tienen que ver entre sí.​
El SIDA comenzó con 2 enfermedades. Hoy son 28. El COVID1984 comenzó siendo una neumonía, hoy ha mutado en un pulpo nosológico que incluye desde cefalea a diarrea, pasando por depresión y hasta calvicie.​
En un momento dado de la “epidemia” todo pasa a estar basado en “tests” que no resisten 1 hora de análisis crítico de sus fundamentos científicos.​
En el SIDA ese momento llegó en 1985 (tras 4 años de “epidemia”) con la aparición del (mal llamado) “test de VIH”. En el COVID1984 todo va a X400 de velocidad con respecto al SIDA y el protagonismo ha pasado a los tests en apenas unos meses.​
La literatura apologética de la “epidemia” de los “casos ejemplares” (ver post inferior)​
En los 80 leí sesudos “análisis” que profetizaban que moriría de SIDA 2/3 de la humanidad. Otros analistas eran más moderados y decían que sólo moriría 1/4. Este fue el impacto real del TimoSIDA en la población mundial:​

Nulo. El “VIH” ha tenido un impacto nulo sobre la población mundial.​
Les recuerdo que oficialmente en los años 80 tuvimos una “pandemia de transmisión sexual” de un “virus mortal”. Como dice Peter Duesberg, los embarazos son una excelente prueba de sexo no “protegido”, luego, la gente seguía teniendo “sexo no protegido” a mansalva. No hubo “explosión de SIDA entre heterosexuales” como se vaticinó en los 80. ¿Motivo? Los heterosexuales apenas consumen Poppers (Nitritos inhalables) ni son el objetivo principal de la industria del TimoSIDA, a diferencia de los Homosexuales.​
En los 80 se nos dijo que África se estaba quedando “despoblada” por el SIDA. África ha doblado su población desde entonces.​
En los 80 se dijo (en serio) que el SIDA impondría una vuelta hacia las relaciones monógamas estrictas y a la castidad y el casarse vírgenes entre los jóvenes, únicas garantías (decían) de no contraer el letal virus de transmisión sexual.​
El salirse de la virginidad y la monogamia (se nos dijo en los 80) suponía el peligro cierto de morir de SIDA. En serio de lo digo. Aclaro que la licenciosidad sexual de los 80 era una fracción de la actual.​
Hasta tuvimos nuestra expectación ansiosa de la parusía de la “vacuna contra el SIDA”, anunciada varias veces a lo largo de los 80:​
Mucho me temo que en 2020 estamos aún en el 1985 del TimoSIDA, esto es, hay papayatest pero aún no hay “truco-trato-miento” para “asintomáticos”.​
Mucho me temo que a no tardar mucho van a sacar un truco-trato-miento para “asintomáticos”, como hicieron en 1986 con el AZT:​

AZT​
A Z, o sea, Alpha y Omega, Nacimiento y Muerte.​
T de Stauros, Tau, o sea, cruz de sacrificio.​

AZT: Nacimiento y Muerte en ritual de sacrificio.​

La etiqueta del AZT de laboratorio es muy explícita:​

Esto empezó en los 80 (el AZT sigue administrándose y forma parte de la “farmacia básica” de la OMS).​
En 2020 me temo que estamos a meses de que saquen un “truco-trato-miento” para “asintomáticos” que resuelva este incomodísimo problema de los miles y miles de “infectados” por el letalísimo virus que gozan de perfecta salud.​
El AZT en 1986 “resolvió” el “problema” de los “VIH+” que seguían sanos. Vaya si lo resolvió.​
Y en 2020 (ojalá me equivoque) temo que en breve van a sacar un AZT redux que haga que la hipnozumbólica narrativa de los “asintomáticos enfermos” (oído en RNE: “Instalado hospital para enfermos asintomáticos) pase a ser una realidad. Están ya hablando de que los “asintomáticos” en realidad van a sufrir tales y cuales secuelas permanentes, así que me temo que no va a pasar mucho tiempo hasta que les ofrezcan su truco-trato-miento.​

Se cree en la Plandemia como en dios, por fe:

 

NATURE|”Coronavirus CoVid19″ incapaz matar un ratón de laboratorio.Sólo produce afecciones leves.Falla 1er/3er Postulados Koch como causa de epidemia

 

No hay evidencia alguna de que el “SARS Cov 2” cause “Covid1984“.

 

Antes bien, hay evidencia de lo contrario:

La mera existencia de porcentajes cada vez más absurdos de “asintomáticos” desmiente la causalidad del “virus” por primer postulado de Koch:

El agente debe estar AUSENTE EN SANOS.

 

Si un 80% de los “infectados” están sanos, es que el agente NO PUEDE SER la causa de la enfermedad. Lógica elementalísima.

No importa, se cree en la causalidad por fe en el consenso social, lo mismo que en Arabia Saudí se cree en Alá porque todo el mundo (allí) cree en Alá.

El que disienta del consenso social sobre la COVID1984 empieza a tener los mismos problemas que tendría en Arabia Saudí quien empiece expresar disensiones sobre el consenso social sobre Alá.

 

Los tests tampoco resisten el menor análisis crítico:

No importa. Los massmierda y los castuzos siguen repitiendo “contagiados confirmados por PCR”, en flagrante contradicción con el mismísimo prospecto de los tests. (Nota UTP. Ver el anterior artículo sobre PCR en este mismo blog)

 

Cuando se entra en un sitio tienen el puñetero gel en la puerta nada más entrar, como el agua bendita en las iglesias.

La religión covidiana tiene sus propios rituales. Como el del “agua bendita”…glicerina y alcohol santificado.

 

 

Y fascinante noticia:

Los obispos piden retirar el agua bendita y no darse la mano en la paz ante al avance del coronavirus

El HIDROGEL sustituye al AGUA BENDITA, hasta en la Iglesias y a iniciativa de los obispos.

Es un reemplazo total de una liturgia nueva a otra liturgia vieja.

¿La secta de los covidianos se marcará un Waco y se inmolara en masa?

Waco no.

Van a tener un Jonestown, me temo.

Jonestown – Wikipedia, la enciclopedia libre

Les van a dar un Kool Aid para “tratar a los asintomáticos”. ¡Ojalá mi temor sea infundado!

Y se lo van a tomar, como se tomaron el AZT en su día, como vacunan a sus hijos, como aceptan recibir “Quimioterapia” y como se radian las tetas todos los años recibiendo órdenes.

De esto no tengo ninguna duda, desgraciadamente.

La Plandemia tiene un rito iniciático, doloroso, como suelen ser los ritos iniciáticos.

Dolor, lágrimas y hasta desmayos: por qué duele tanto que te hagan una prueba PCR

Es como cuando en la Confirmación te daban una bofetada:

¿para que sirve la cachetadita que te da el obispo en la confirmación? | Yahoo Respuestas

Este simpático cura les explica la “cachetada del obispo”:

 

La cachetada ahora ha quedado muy atenuada, un mero símbolo.

Observen por favor que los massmierda hablan siempre de SOMETERSE a “tests PCR”:

 

someterse test covid – Buscar con Google

 

Es un rito, uno simboliza su SUMISIÓN a la neo religión participando en uno de sus más molestos sacramentos.

Es muy habitual que un rito iniciático sea INTENCIONADAMENTE molesto y doloroso:

Los ritos de aceptación en grupo suelen ser intencionadamente desagradables.

Karatekas.

 

Atención a los bastonazos desde 40″. Duele verlos y oírlos. Practico Shotokan y a veces dudo si los estimados compañeros de Kyokushinkai son los que practican el Karate más auténtico o sí -quizás- lo que pasa es que están un pelín chiflados.​
En Shotokan también recibimos golpes para entrenarnos, golpes mucho más suaves. El shock psico-físico de recibir un golpe es inexplicable para quien no lo haya recibido.​
Al estar acostumbrados a golpearnos ritualmente unos a otros los Karatekas nos sentimos integrados en el grupo y diferentes al resto de no-practicantes, ya que nosotros podemos aguantar el rito de ser golpeados y además lo aguantamos voluntariamente, así que nosotros somos un grupo cohesionado, aparte del resto, de los no-iniciados.​
Creo que lo mismo pasa con los miembros de la Iglesia Covidiana que se someten al rito de paso del hisopado para PCR.​

 

El adepto se somete voluntariamente a un rito molesto y doloroso. Al SOMETERSE al rito demuestra (ante sí mismo y ante los demás) su adhesión al grupo.

Las largas colas para hacerse la PCR (horas y horas, a veces bajo el Sol, y a veces tras horas de espera no hay PCRs para todos) son otra parte del rito: El adepto debe sufrir para poder conseguir su ansiado (y doloroso) Sacramento.

colas pcr – Buscar con Google

 

 

Largas colas para hacerse las pruebas PCR en Sabadell

Larguísima cola al Sol con Orwellianas admoniciones contínuas por megafonía No bajes la guardia, manten la distancia de seguridad

El ambiente es el de Lourdes:

 

 

O el del Haj islámico:

 

 

Pilgrims flock to Mecca for Haj

Sol, Calor, Sed, Incomodidad, Cansancio, larguísimas esperas y un ambiente de ansiedad compartida entre todos los participantes en el rito.

 

Salvador Freixedo decía que tales lugares de ANSIEDAD COMPARTIDA son puntos de recolección energética para quienes de verdad montan el show.

A veces tengo la sensación de que las colas agotadoras para hacerse la PCR son INTENCIONALES, una forma de poner a prueba la Fe del Adepto y su resolución a recibir el Sacramento….y de mejorar la recolección.

 

Mentalidades más bien simples se asombran y protestan porque sea tan difícil y fatigoso hacerse la ansiada PCR.

No entienden que la dificultad y la incomodidad es parte del ritual sacramental, lo mismo que para hacer la Primera Comunión antes debes someterte obligatoriamente a la fastidiosa Catequesis.

 

El mero hecho de que CREEN AGLOMERACIONES PARA HACER PCRs es autocontradictorio: Para el INGSOC del COVID1984 las aglomeraciones son dobleplusmalas.

Deberían dar hora escalonadamente…si creyesen de verdad en su propio Credo Covidiano.

Pero no creen: El sacramento debe ser difícil de conseguir para ser psicológicamente satisfactorio para el adepto. Por eso tienen horas esperando a los adeptos ansiosamente bajo el Sol.

 

La PCR es una especie de SACRAMENTO PENITENCIAL (como la CONFESIÓN católica):

Los creyentes se someten a la CONFESIÓN para lavar sus pecados. Y es un mal trago confesarse, algo que uno “debe pasar”. Quienes nunca hayan participado de este rito (yo me confesaba de jovencito creyendo realmente en el sacramento) nunca lo podrán entender.

Los adeptos COVIDianos se someten a la PCR para lavar y expiar sus pecados COVIDológicos, como estar sin mascarilla o “divertirse demasiado” (salirse de la BURBUJA SOCIAL, como ya dicen abiertamente los NEOCURAS COVID1984)

NUEVA VIDA Covidológica, como la NUEVA VIDA del cristiano converso:

El adepto Covidológico puede pecar quitándose la mascarilla o saliéndose de su BURBUJA SOCIAL.

SOMETERSE a la PCR es la confesión COVIDológica que restaura la gracia y reasegura su no-contaminación al adepto.

El Ministro Illa ya ha dicho que “no hay que estigmatizar” a los que tienen que hacerse PCRs por haber pecado.​
Me recordó a las admoniciones de mi colegio católico sobre que no criticásemos jamás a quienes iban a los confesionarios del Colegio, ya que “todos somos pecadores”.​

CONFESIONES MASIVAS CATÓLICAS:

CONFESIONES MASIVAS COVIDOLÓGICAS

Los SACERDOTES COVID llevan tambien ROPAS SACRAMENTALES.

Psicológicamnete para el adepto el SIGNO de Sacramento es tan importante como el Sacramento en sí. Por eso es tan importante la PARAFERNALIA del sacerdote que imparte el Sacramento: Casulla o Sotana en los sacerdotes y disfraz de liquidador de Chernobyl en los Sacerdotes COVIDianos.

El Hisopo de los papayatest nombra también a un artilugio RELIGIOSO

¿Son las pruebas COVID una forma de infectar o implantar personas subrepticiamente?

¡Qué casualidad! Es el nombre de un artilugio religioso:

Veamos la imprescindible definición:

hisopo | Diccionario de la lengua española

hisopo1
Del lat. hyssōpus, este del gr. ὕσσωπος hýssōpos, y este del hebr. ‘ēzōb.
1. m. Mata muy olorosa de la familia de las labiadas, con tallos leñosos de 40 a 50 cm de altura, derechos y poblados de hojas lanceoladas, lineales, pequeñas, enteras, glandulosas y a veces con vello corto en las dos caras; flores azules o blanquecinas, en espiga terminal, y fruto de nuececillas casi lisas. Es planta muy común, que ha tenido alguna aplicación en medicina y perfumería.
2. m. Utensilio que se emplea en las iglesias para dar o esparcir agua bendita, consistente en un mango de madera o metal, con frecuencia de plata, que lleva en su extremo un manojo de cerdas o una bola metálica hueca y agujereada.
3. m. Manojo de ramas pequeñas que se usa para esparcir agua bendita, como lo autoriza o manda la liturgia en algunas bendiciones solemnes.
4. m. Arg., Méx., R. Dom., Ur. y Ven. Palillo recubierto de algodón en sus puntas, usado para la higiene personal.
5. m. Chile. Brocha de afeitar.
6. m. Col. Escobilla, ordinariamente hecha de fibra de fique, empleada para blanquear o pintar paredes.
7. m. Cuba. Varilla delgada de alambre trenzado con un estropajo en el extremo, que se emplea para fregar recipientes de boca estrecha.
hisopo2
Del lat. oesy̆pum, y este del gr. οἴσυπος oísypos.
hisopo húmedo
1. m. Veter. Mugre de la lana de las ovejas y carneros, que se recoge cuando se lava la lana, y, al evaporarse, deja una materia sólida y jugosa como si fuera ungüento.

Vaya, vaya.

O sea que el Hisopo se usa “para esparcir agua bendita“.

No nos “esparcirán” nada con él, ¿verdad?

Hisopo también es…Mugre. O artilugio para blanquear paredes.

¿Blanquean acaso algo con las PCRs? ¿O hay algún tipo de mugre en ellas?

Podrían decir “bastoncillo”, pero no, dicen “hisopo”.

Y en todos los demás contextos con el hisopo se DEPOSITA algo donde hisopas. Excepto con la PCR que sólo coges, no dejas nada. Porque no dejan nada con el Hisopo, ¿Verdad?

Las PCRs obligatorias como penitencia a los pecadores

Ya hacen PCRs obligatorias en Aeropuertos en varios países:

You Can Now Be Tested For COVID-19 By Lufthansa In Germany

Va a ser la norma:

Bruselas pide evitar cerrar fronteras y en su lugar aplicar cuarentenas y PCR – Buscar con Google

Lógico. Muy lógico. Dentro de esta Neo Religión.

Has pecado contra la Agenda 2030 al viajar en avión. Es perfectamente lógico que te impongan una penitencia PCR por pecador:

No cierran las fronteras de Iure.​
Pero las cierran de Facto. A no ser que estés dispuesto a SOMETERTE a su ritual de penitencia PCR.​

Les apuesto a que Pedro Sánchez NO le hacen la PCR si viaja a Alemania. ¡Aún hay clases! El partido Interior tiene BULA PAPAL para viajar en avión. Los Proles deben hacer penitencia por sus pecados medioambientales. El Inner Party no.

Que la PCR en el aeropuerto no tiene nada que ver con ninguna “pandemia” y es una pura penitencia lo deduzco por el siguiente echo:

Si eres “contacto” en España y das “negativo” ESTAS OBLIGADO IGUAL A HACER CUARENTENA, porque -dicen- aunque des “negativo” puedes estar “infectado “igual”. Te chupas igual tus 10 o 14 días de cuarentena.​
Pero -contradicción- si das “negativo” en el aeropuerto eres libre para transitar el país de destino. Con lo cual se ve que la PCR aeroportuaria es un mero fastidio, una penitencia para los que aún hagan algo “contra agenda 2030”, como viajar en avión, por ejemplo.​
Si el “negativo a PCR” no descarta “infección” en “contactos”, tampoco debería descartarse en pasajeros aéreos.​
No descarto en el futuro PCRs en fronteras internas entre taifas dentro de expaña, estilo la propiuska (pasaporte interno soviético), lo cual de facto limitaría aún más la movilidad…lo cual es un objetivo de la Agenda 2030 llamado “movilidad sostenible”. (eufemismo para INmovilidad para los proles y movilidad para el Inner party)​

La Grey COVIDiana termina siendo tratada como ganado:

Carpa tests PCR en Sabadell. Rebaño al Redil Del Coronavirus por si desaparece, video para descargar.

Observen por favor la TRAMPA PARA GANADO para ADEPTOS a la Iglesia Covidiana.​
Tranquilamente te dicen que debemos alcanzar la “inmunidad de REBAÑO”:​
Los que antes de vacunarnos estamos dispuestos a abandonar España somo acusados de sabotear tal “inmunidad”, o sea, de SALIRNOS DEL REBAÑO “inmune”.​
Nada nuevo bajo el Sol: Las viejas religiones usan liberalmente la metáfora de llamar ganado a su Grey:​
Como resumió magistralmente un forero En la Nueva Subnormalidad Medicina y Veterinaria han pasado a ser la misma cosa.​

Adicionalmente la LITURGIA de la PCR tiene a veces rasgos de LITURGIA DE RENACIMIENTO:

(Quien crea que los massmierda han escogido esta foto “por casualidad” es que no sabe qué son en realidad los massmierda: Medios de ADOCTRINAMIENTO de masas)​

La sacerdotisa con ropas litúrgicas y “sonriendo con la mirada” nos invita con los brazo en CRUZ sacrificial al Coño-Carpa , el útero simbólico donde el adepto renacerá tras su PCR.​

Las cortinas de la Coño-Carpa son el órgano Sexual simbólico por el cual uno renace en la Fe Covidológica tras someterse al rito de paso del Hisopado.​

Renacer, como en el Cristianismo:

La erección de carpas Covid1984 es un RITUAL de la Iglesia, y por lo tanto es noticia en todos los massmierda, que anuncian que se erige CARPA COVID en tal o cual ciudad lo mismo que se anunciaba hace décadas que la SANTA CRUZADA, ACCIÓN CATÓLICA o cualquier REVIVAL RELIGIOSO similar organizaba un sermón de masas en tal o cual ciudad.

La Carpa es el ÚTERO Y EL COÑO ritual en el cual el adepto renace.

En realidad es un disparate erigir carpas para hacer test, porque, ¿acaso no nos han dicho que estar al aire libre es más “seguro” ante la COVID1984?

mejor quédate en espacios abiertos

Pero luego hacen las tomas de muestra de las PCRs en espacios cerrados.​
​Enteramente contradictorio.​

Pero no importa, creer absurdos es parte de cualquier religión:

Pasar de esto

A esto…

El creer cosas contradictorias al mismo tiempo es el marchamo de una religión:

Dios, trino y uno.
La Virgen, Virgen y Madre.
Jesucristo crucificado pero victorioso.
El coronavirus, contagiosísimo pero Pedro Sánchez y Pablo Iglesias NO fueron contagiados por sus parejas contagiadas.
La COVID1984 no genera inmunidad duradera, pero vamos a obtener una vacuna efectiva de todos modos.
No ha habido nunca vacuna contra el coronavirus del resfriado, pero la va a haber contra el coronavirus del COVID1984, y muy pronto.
El coronavirus es letal y terrible, pero el 80% de los infectados deben hacerse un test para enterarse de que estan infectados.
El coronavirus se expulsa por la saliva y hasta en el humo del tabaco, pero para detectarlo vía PCR hay que meter una sonda casi en el cerebro:
Para contagiar los “asintomáticos” van tirando virus por todas partes, a 2 metros (o hasta 5) de distancia.​
Pero misteriosamente para una PCR hay que ir a buscar al virus que el asintomático va difundiendo a metros de distancia metiendo un hisopo casi hasta el cerebro:​
​Absurdos y mas absurdos como tener que estornudar en el codo para prevenir contagios…
…para luego que te indiquen que ahora hay que saludarse con el codo.
La creencia en absurdos es el marchamo de la fe religiosa:

La Plandemia tiene actualmente su rito mayor: SOMETERSE a una PCR.

 

Pero los adeptos aguardan expectantes a la parusía del nuevo rito máximo de la neo-religión: LA VACUNA.

 

La vacuna será (si la sacan, la del SIDA nunca la han sacado, pese a tener varias “Listas” en los años 80) el nuevo SACRAMENTO MÁXIMO del creyente, como la COMUNIÓN CATÓLICA:

En la mente del creyente católico la Comunión protege de los demonios que acechan en el Mundo. Uno aumenta su “gracia” comiéndose al fundador de la religión.

Igualmente en la mente del creyente COVIDiano la Vacuna será el Sacramento que protegerá al adepto del dios COVID1984.

Además el manifestar uno su entusiasmo ante la idea de vacunarse supone comunicar al resto de fieles que uno es un buen fiel, lleno de fe y confianza en la Iglesia.

Pero -ah- uno ha de ponerse la VACUNA CORRECTA, NO LA DE PUTIN:

Comulgar con la vacuna de Putin sería una herejía, es como si un Calvinista asistiese a una misa católica, o como si un católico comulgase en el rito de Comunión de los Testigos de Jehová. ¡Un buen fiel sólo consume Hostias Consagradas de su propia denominación cristiana!​
Igualmente, la Iglesia Covidiana en España predica a sus fieles que esperen a la Hostia Consagrada Vacunal “correcta”, la aprobada por la Iglesia local, y no la Hostia Consagrada Vacunológica de la secta hereje de Putin. ¡Vacuna de Putin! ¡Sea Anatema!
La vacuna de Putin sería un Falso Mesías para “confundir a los fieles”.​
La aparición de “Falsos mesías” ha ido generando innumerables sectas a lo largo de la Historia:​
(Nota UTP. Recomiendo encarecidamente al lector leer el magnífico libro El mandril de madame blavatsky de Peter Washington)
Es muy interesante trolear a los creyentes COVIDianos españoles preguntándoles si se pondrían o no la vacuna de Putin. Bueno, YA tienen “vacuna”, ¿por qué no viajan a Rusia a ponérsela YA? Es divertidísimo verles responder que “no es segura”, que es lo que les han contado los Popes covidológicos españoles, que son de una “denominación covidológica” diferente. (como si los Putinianos fuesen Herejes Protestantes de cuyos ritos un buen católico español jamás debiese participar)​
Es francamente divertido ver reaccionar a los massmierda locales ante la vacuna de Putin con toda la cautela y el escepticismo que NO tienen nunca con las gilipolleces de la Iglesia COVIDiana.​
Supongo que cuando saquen nuevas vacunas (si las sacan) los massmierda publicarán encíclicas orientando a los fieles sobre cuál es la vacuna “correcta” para comulgar adecuadamente.​
No descarto hasta que haya “vacunas preferidas” según las filias y fobias de cada Borregomatrix:​
Los VOXeros preferirán la de Moderna, otros la de Bill Gates (¿o es la misma?), quiźas haya una vacuna “de Trump” que los progres rechacen…es como si en Jonestown el Reverendo Jones te dejase escoger el sabor de tu Kool Aid.​
Pero la de Putin…¡esa vacuna no! ¡vade retro! La Plandemia no admite disidentes ni devociones a sectas rivales, como las religiones.​

 

La Cuaresma Covidiana

La Plandemia nos castiga sin diversiones mundanas: Bares, Discotecas, Fiestas…

 

 

El pecador además debe dar sus datos, porque “no debes tener nada que ocultar”…​

 

 

…al estilo de los váteres sin puerta de los Colegios de posguerra estilo “Auxilio Social”.​

 

Estamos actualmente en la CUARESMA de la Iglesia COVIDiana: Discotecas cerradas y sin fiestas de ningún tipo. Prohibido bailar. Prohibido fumar. Prohibido hacer corrillos en la calle.

Y pronto, toque de queda. Como en las dictaduras. ¿He escrito “dictadura”?

 

La Expaña del COVID1984 empieza a parecerse a las repúblicas teocráticas rigoristas, estilo Ginebra de Calvino, Florencia de Savonarola o Teocracias rigoristas Islámicas (talibanes, ISIS…)

El poder de Savonarola se verá reflejado en la nueva constitución de Florencia: Se declaró a Cristo como el rey de Florencia, se creó un Gran Consejo de Estado, los impuestos fueron reformados, prohibió la usura, ordenóse la administración de justicia y se eliminaron las instituciones (parlamentos) que habían explotado los Médici para mantener su dominio.1
Como ahora estaba en el poder, persiguió ferozmente a los homosexuales, las bebidas alcohólicas, el juego, la ropa indecente y los cosméticos. Savonarola ordenó a la policía que buscara por la ciudad cualquier cosa que permitiera la vanidad o el pecado como tablas de juego, libros eróticos, peinetas, espejos, perfumes, cosméticos y ropa indecente (vestidos femeninos demasiado escotados, calzas masculinas demasiado apretadas) que fueron confiscados por la policía y echados a la llamada “hoguera de las vanidades“, una inmensa hoguera que ardía en la plaza principal de la ciudad. También se quemaron instrumentos musicales, cuadros mitológicos, algunos obras maestras del Renacimiento, libros con la poesía profana de Petrarca y Bocaccio, libros de los antiguos escritores clásicos de la civilización romana y griega de incalculable valor, por ser considerados inmorales. La violencia dirigida por Savonarola se extendió por toda la República de Florencia, en un intento de obligar a los ciudadanos a que retornasen a unas costumbres sencillas.

¡Arrepentíos pecadores!

Dejad vuestras fiestas y oropeles mundanos, abandonad el Mundo y sus tentaciones y recluiros en vuestra Burbuja Social, y haceos una PCR para obtener el perdón del dios COVID

Rezad para que pronto aparezca la vacuna, con la cual seremos salvos.

 

Para colmo se celebran las NO fiestas, en un extraño ritual de recordar obsesivamente que estamos bajo la nueva subnormalidad que nos trae el dios COVID1984.
Hay que celebrar que NO estamos en fiesta, lo mismo que los aplaudebalcones  (#balconazis) celebraban estar en arresto domiciliario.
La Cuaresma Covidiana se nos repite contínuamente (y desde el momento cero, en marzo) que sólo terminará cuando llegue el Mesías, o sea, la Vacuna Verdadera. (no el Falso Mesías de la Vacuna de Putin, por supuesto)​
Esta esperanza en la vacuna es un disparate incluso dentro de la ortodoxia médica porque en realidad las mascarillas YA ofrecen más protección teórica que cualquier vacuna esperable:​
Repito e insisto: Aún dentro de la ortodoxia médica más estricta las mascarillas YA deberían estar dando más “protección” (60-90%) que cualquier vacuna previsible.
Da igual, vamos todos con mascarillas, la “epidemia” nos dicen que está “disparada” (en “+” a papayatests) pero que todo se arreglará con la “vacuna” (cuya eficacia teórica es inferior a la de las mascarillas)​

No descarto que el advenimiento del mesías (de la vacuna) se retrase ad calendas graecas, como la “vacuna contra el SIDA” (esperadísima en los 80, olvidada por completo hoy al ser el “VIH” ya una FE MUERTA) o la misma Parusía de Jesucristo, anunciada en el Nuevo testamento para el Siglo I de la era cristiana (cfr. vgr. 1 Tesalonicenses 4:15)

El advenimiento de la deseada vacuna puede ser un mero truco de manipulación de masas, que se posponga indefinidamente, exactamente como el advenimiento de Jesucristo, anunciado para el Siglo I E.C. y pospuesto indefinidamente desde entonces.​
Pero TEMO que acabarán sacando la vacuna. Quizás sea el Kool Aid del Jonestown COVIDológico.​
Desde Marzo tengo la sensación de que todo el confinamiento y la nueva subnormalidad es en realidad la campaña de venta para convencer a los borregomatrix de la “necesidad” de la “vacuna”, una especie de “te vuelvo loco hasta que me supliques que te vacune”.​
La Plandemia es un castigo porque “hemos sido malos”, una penitencia para-religiosa.

Una empleada de una “Farmafia” me dijo un chiste interno de empresa:

El virus somos los humanos, el COVID es la vacuna de la naturaleza para curarse de nosotros.

 

El COVID1984 es un nuevo dios de la naturaleza que ha venido a “ponernos en nuestro sitio” por nuestra “conducta desordenada”.

Sin explicación de ningún tipo en los massmierda nos bombardean con “verdades evidentes” (imbecilidades XXXL) como Non sequiturs como que la Plandemia es una consecuencia del Calentamiento Hueval o la Pérdida de Biodiversidad. (joder si el “SARS Cov 2” es en teoría una mejora de la biodiversidad, ¡un virus más en circulación!, qué halegría para un ekologista, hoyjan) Van a terminar diciéndonos (y sin reirse) que la Plandemia ha sido causada por el Machismo, el Racismo y la Xenofobia.

Aplaudir en los balcones como rito de adhesión a la neoreligión.

Lo mismo que se cantan saetas a la Virgen desde los balcones en semana santa.

Los fieles COVIDianos manifiestan su adhesión a la nueva causa social lo mismo que los fieles católicos manifiestan su adhesión Mariológica: Con ruidosas y emocionales manifestaciones desde sus balcones.

Se trata de CREER, no de PENSAR.

La paradoja es que el rito era totalmente contrario al INGSOC Covidológico de por qué nos arrestaron a todos durante casi 2 meses:

Todos arrestado en casa para “no contagiarnos”.

Y todos al balcón (¡sin mascarilla!, entonces era “contraproducente”, ¿recuerdan?) a la misma hora a cantar, bailar y aplaudir:

 

N.ENGLAND JRNL OF MEDICINE.SARS se diseminaba entre pisos por AEROSOLES CARGADOS DE VIRUS. ¿Deberíamos mantener cerradas ventanas y NO SALIR A BALCÓN?

 

Y ahora nos dicen que el mutante y todopoderoso dios COVID llega a 5 metros de distancia:

¿Hay acaso 5 metros entre apludebalcones (para colmo sin mascarilla) y aplaudebalcones?

Sin mascarilla, fumando (a veces) y sin la Nueva distancia de seguridad de 5 metros.​

Reexaminar las prácticas de la Iglesia COVIDológica del pasado es tan de “mal espíritu” como reexaminar las prácticas religiosas del pasado.

 

¿Sabían ustedes que al principio del Cristianismo uno esperaba a estar muriendo para bautizarse?​
¿O que hasta los Obispos se casaban?​
¿Sabían que la confesión auricular católica tardó siglos en aparecer?​
Lo mismo que las prácticas religiosas pasadas no soportan un reexamen…​

…las prácticas religiosas COVIDológicas de marzo.abril son ya impresentables en agosto, a la luz de las “nuevas revelaciones” de la Secta.

Barrunto que los apludebalcones del próximo confinamiento recibirán órdenes de salir a aplaudir con mascarilla. Y las obedecerán, por supuesto.


Nota UTP.  El tema religioso simbólico del primer confinamiento lo explicamos aqui.

UTP86 Coronavirus, Akituatraco a las 8

 

El mismo dia 14 de marzo que el Gobierno decretaba el estado de alarma para hacer frente a la expansión de coronavirus COVID-19 se viralizaba en las redes sociales el hastag UnAplausoALosHeroesSanitarios donde se nos pedía salir al balcón a las 22 horas para homenajear a nuestro personal sanitario por sus esfuerzos. Las 22 horas, o sea las 10 de la noche se puede tomar como un doble 11. Este mensaje se difundió como la pólvora sobre todo por wasap, Twitter y Facebook…no quedó un alma sin enterarse.

Posteriormente y con la excusa de que los niños también querían participar se paso esta supuesta iniciativa popular a las 8 de la noche y a esa hora es a la que ha quedado fijada ya definitivamente hasta que acabe esta cuarentena o falsa cuaresma…cuaresma pagana de la tragipandemia.

El 8 es muy importante para la adoración de Ishtar la diosa babilónica del amor y la belleza, de la vida, de la fertilidad o sea de la primavera. Se la asocia al planeta Venus, estrella de la mañana y del anochecer. Su símbolo es una estrella de ocho puntas. En su honor, los astrónomos han llamado Ishtar Terra a un continente de Venus.

Ištar no es una diosa del matrimonio, ni es una diosa madre. El matrimonio sagrado o la sacra hierogamia, que se representaba todos los años en el templo babilónico, no tiene un implicación moral ni es modelo de matrimonios terrestres, es un rito de fertilidad altamente estilizado con tonos litúrgicos.

 

 

Akitu o Akitum ( sumerio :ezen á.ki.tum , akiti-šekinku , á.ki.ti.še.gur₁₀.ku₅ , lit.”el corte de cebada”, [ cita requerida ] akiti-šununum , lit.”cebada -siembra “; acadio :akitu o rêš -šattim ,” cabeza del año “) fue un festival de primavera en la antigua Mesopotamia . El festival babilónico de Akitu ha desempeñado un papel fundamental en el desarrollo de las teorías de la religión, el mito y el ritual. Si bien el propósito del festival sigue siendo un punto de discusión entre los historiadores de la religión y Asiriólogos , es seguro que han desempeñado un papel fundamental en el establecimiento regular de una agenda, prioridades y en el avance general de la civilización occidental como uno de los primeros foros que ocurren regularmente donde las propuestas para el mantenimiento social o el cambio podrían hacerse consistentemente y cuestiones cruciales que se abordan fácilmente.

Para nosotros también hay una vertiente religiosa en todo esto y creemos que quieren derivarlo hacia alguna religión nueva era mezclada con extraterrestres.

UTP89 Coroniviru, balconazis y MagUFOs

Les recomiendo escuchar el primer programa de Desmontando a Babylon y como se sugería en el Informe Iron Mountain el crear una nueva religión para sustituir a la guerra convencional.
Fin de la Nota UTP. Sigamos con el texto de AYN RANDiano2

Los neocuras del COVID1984: Simón, los “expertos” y “las autoridades sanitarias”.

Testigos de Jehová: “La luz de Jehová se hace poco a poco” para explicar sus garrafales fallos proféticos.

¿Será que los testigos buscan traer el NWO?

Igualmente la Iglesia Covidiana dice que “estamos empezando a entender el virus” para explicar sus errores.

La COVID1984 tiene “Misterios”:

Por ejemplo:

Donde existen más medidas contra la COVID1984 hay más casos.

Donde menos medidas se toman hay menos casos.

Debería ser al revés, pero el adepto debe aceptar sin más este MISTERIO.

Como las religiones:

En el Colegio Católico se nos advertía sobre que NO intentásemos entender ni explicarnos Los misterios.

Había que CREER en ellos. Punto. Todo intento de comprensión intelectual podía llevar a la herejía o el extravío.

Lo mismo con la COVID1984: Se advierte a la grey de que CREA en la versión oficial del momento sobre el “virus”, el cuestionarla o hacerse preguntas puede llevar al negacionismo o a las tinieblas exteriores de las Fake News (Fake News: Cuando las mentiras nos las cuentan ellos)

Igualmente la Iglesia Covidiana dice que “estamos empezando a entender el virus” para explicar sus errores.

Los casos ejemplares

Antiguamente a los niños se les “educaba” con “casos ejemplares”.

Por ejemplo un niño cometió un pecado mortal. Por pereza no se confesó. Murió esa noche y por lo tanto pasará toda la eternidad en el infierno.​
En serio que estas historias se contaban a los niños.​

El TimoSIDA tuvo también sus casos ejemplares. Por ejemplo:

“Una sola noche” de sexo “desprotegido” bastaba para “contagiarse”:​
Champagne, Rosas y SIDA…en su estreno sexual. ¡Ya es mala suerte!​
Que muriese tomando AZT no tuvo nada que ver, claro que no, la calavera y las tibias sobre fondo naranja (MUY TÓXICO) las pone el fabricante del AZT en la etiqueta porque hacen bonito, no porque sea veneno incompatible con la vida.​
¡Una sola noche de sexo basta para contagiarse!​
Luego resulta que parejas estables de Sidosos famosos no se “contagiaron”:​
Sexo anal de pareja estable no se sabe cuantas veces, ¡y no se contagiaron nunca!​
Pero la pobre Alison Gertz se contagió con una sola noche de sexo vaginal. Para colmo la primera. (y última con su “contagiador”)​
Pero bueno, la verdad o la coherencia no cuenta al confeccionar un “caso ejemplar”.​
Otro “caso ejemplar”:​
La jovencita virgen e inocente que se contagia (no se sabe cómo) en el dentista “seropositivo”.​
Luego resulta que la jovencita no era tan, tan virgen como decía:​
Y cómo apunta Peter Duesberg, la tasa de “VIH+” entre los pacientes del dentista era exactamente la misma que la “seropositividad de fondo” en los USA. El dentista no se puede decir que “contagiase” a nadie.​
Que la pobre Kimberly Bergalis tomase AZT tampoco tuvo naaaaaaaaada que ver con su muerte, obviamente.​

 

La COVID 1984 nos está trayendo ya similares “casos ejemplares”. Algunos ejemplos:

 

¡Bonita camiseta eh! ¡Todo un superhéroe!

 

Un incrédulo converso al ser tocado por el dedo del coronavirus, como Saulo tocado por YHVH camino de Damasco.​
Otro caso:​

 

 

¡Sin patologías previas! ¡Y a los 11 años! ¡Qué más evidencia necesitan los negacionistas para convencerse! ¡Que encallecido corazón negacionista no se ablanda ante una pobre niña muerta!​
Bueno, sí tenía patología previa:​

 

Según rascas todos los “casos ejemplares” van desmoronándose, como el de Kimberly Bergalis.

 

PERO la exposición massmièrdica al DESMENTIDO del “caso ejemplar” es UNA FRACCIÓN del caso ejemplar en su apogeo:

Por ejemplo todos los americanos vieron a Kimberly Bergalis en silla de ruedas llorando en el juicio contra el state del dentista, pero sólo una fracción supo que no era “virgen” y que tomaba un veneno incompatible con vivir (AZT)

En cuanto a encontrarnos siempre con los mismos números, 11 ó 33, pues ya roza el esperpento.

 

11 medidas, como el 11S o el 11M.

3 recomendaciones, trinidad.

 

Los infieles que rehúsen comulgar con la vacuna serán los culpables de su fracaso:

 

HuffingtonPost|”El virus seguirá circulando incluso después de que se ponga en circulación una vacuna por culpa de los antivacunas”

 

Esto es como la idea musulmana que la Paz Universal llegará el día que el último infiel se haya convertido al Islam.

Ese día no llegará nunca (espero), lo mismo que las vacunas que saquen ya tiene “explicado” su fracaso. ¡El fracaso de las vacunas será culpa de los antivacunas!

 

Es como si estuviesen absolutamente seguros por los ensayos anteriores que no hace falta engañar mucho. Han medido el nivel de estulticia de la población y la corrupcion general de nuestros dirigentes y han actuado en el momento perfecto sin mirar como esconder pruebas. Les importa tres cojones porque tienen todo atado a nivel oficial y de comunicación.

Evidentemente después de esto y sin caretas por medio es imposible creerse ni una coma de los episodios anteriores, la fake gripe A, el fakesida y otro puñado de dolencias que son prefabricadas y falsas hasta la médula.

 

Mi resumen mental sobre la plandemia es que la Sociedad está pagando ahora el precio de aceptar sin interés alguno y sin reacción alguna el TimoSIDA durante 35 años.

35 años de apatía social absoluta frente al TimoSIDA han sido el pavimento de la autopista por la cual ahora llega la Plandemia.

El TimoSIDA era básicamente sólo para los homosexuales y los yonkis.

 

Ahora la Plandemia es para todos. Por no interesarse siquiera en el TimoSIDA durante 35 añazos.

 

Que Fauci esté en ambos enjuagues no es casual en absoluto:

 

 

A este tipo (incombustible, en el mismo puesto al menos desde la era Ronald Reagan es el nuevo Edgar Hoover, ¡qué conexiones tendrá!) se le ha permitido ser el Zar del TimoSIDA durante 35 años.

Pues ahora está en la Plandemia, también de Zar.

Es como los chulos de barrio. O los pones en su sitio o un mal día resulta que se han hecho amos del barrio.

 

Bienvenidos al covidianismo, la nueva fe.

 

(Nota UTP. Este artículo todavía está en construcción en burbuja.,info y quizás sea modificado/ampliado en un futuro)

 


Legal disclaimer

 

Pruebas PCR: El kit de caldo para paellas que nos enfermó a todos

Nunca había sido tan urgente y trascendente buscar y ofrecer la verdad. Y es que nunca había estado toda la humanidad tan cerca del precipicio.

La Tragipandemia, esa locura colectiva que mantiene aterrorizada a casi toda la población mundial por lo menos en el primer mundo, está derivando poco a poco en una terrible dictadura que a poco que no movamos un dedo nos traerá definitivamente su tan querido Nuevo Orden Mundial.

Estamos ante un reset económico y social sin precedentes en la historia y la gente sigue confiando ciegamente en sus captores, en los secuestradores de su libertad, en sus verdugos. Siguen obedeciendo ciegamente a las autoridades sanitarias y políticas y tragándose todos los cuentos para niños que nos escupe la televisión.

Gráfico trucado de forma patética por RTVE para ofrecer la ilusión óptica de que una caída del PIB del 2,6% es similar a una del 18,5%

Parece que no utilizan mucho las matemáticas cartesianas para elaborar sus gráficos y cualquier numero es igual en tamaño.

Y todo gracias a un supuesto virus, el SarsCov2 y al test que supuestamente sirve para detectarlo, el test PCR o reacción en cadena de la polimerasa (Polymerase Chain Reaction).

El test PCR, la máquina de falsificación covidiana, el Paellus Caldus Recipe, el horror que la #ciencia_que_calla no explica de manera comprensible, ese gran invento científico que su descubridor Kary Mullis,  dijo que no valía para realizar diagnóstico médico y que sin embargo es utilizado a nivel mundial para vendernos los casos de la enfermedad Covid19.

Hoy les contaremos que a parte de no servir para nada ya que no detecta en sí ningún virus sino sólo pequeños trozos de ADN, esos tests PCR son un negocio brutal para los laboratorios.

Las farmacéuticas no son precisamente hermanitas de la caridad y los test junto con las vacunas son casi más rentables que los medicamentos ya que estas compañías apenas pierden las demandas judiciales en ninguno de los dos casos. Luego veremos como advierten los fabricantes de las limitaciones de sus test para no pillarse los dedos.

Cada test en USA vale 230$ para 1000 reacciones, o sea podemos realizar un test a 25 personas a ciclos de 40 reacciones. Lo que arroja la no despreciable cifra de 3700 millones de dólares en una población como la de Estados Unidos.

Todo es un negocio en el Covid19 como hemos podido ver con el tema de las mascarillas. Ya que como la gente las utilizaba una y otra vez tuvieron que mostrarnos que son el perfecto criadero de bacterias y hongos y por tanto se deberían de cambiar y desinfectar más a menudo. En vez de reconocer que no existe ni un solo paper científico actual que pruebe que este supuesto virus SarsCov2 se transmite por el aire y que una mascarilla es por tanto necesaria y efectiva para su no transmisión. No, no existe ni un solo paper científico que haya motivado que un pais como España haya impuesto esta dictadura del bozal.

Esta semana pasada trataba de explicarle a una enfermera jubilada que trabajó en quirófano más de 30 años lo que es la prueba PCR y porque su propio inventor reconoció que no servía para verificar carga viral y por tanto no servía para hacer diagnósticos clínicos. Lógicamente al hablarle de Kary Mullis se puso a la defensiva como toda persona adoctrinada por grandes medios de manipulación de masas como el periódico el País, ya que este tipo de prensa manipulada y manipuladora aprovechó de manera torticera la muerte de este premio Nobel para defecar un artículo titulado “Muere Kary Mullis, el Nobel que negaba la existencia del virus del sida y del cambio climático”.

El señor Mullis aprovecho cada momento que le dio la vida para contar la verdad y para buscarla. En ese artículo podemos leer textualmente:

“El mismo diario estadounidense afirmó en 1998 que Mullis era “posiblemente la persona más extraña que jamás haya ganado un Nobel de Química”. En 1994, sólo un año después de obtener el premio, el investigador visitó España para dar la charla de clausura del congreso de la Sociedad Europea de Investigación Clínica, en Toledo, pero se negó a hablar de su gran descubrimiento. En su lugar, decidió divulgar su teoría de que el sida no está provocado por un virus, sino que surge por la exposición a muchos otros agentes patógenos. Mullis, un genio en su campo, demostró que un Nobel puede ser un auténtico irresponsable fuera de su disciplina.”

Comparen lo que el propio Mullis contaba en su libro sobre su conferencia en Toledo con lo que el periódico el País escupe en sus páginas…invitas a un Nobel pero solo si cuenta lo que tu quieres que cuente.

Les invito a escuchar a Kary Mullis a partir del minuto 12 en un fragmento del documental francés publicado en la cadena ARTE “Sida- La duda. Desinformación y ocultación de los medios”, una maravilla que tenía solo 6000 visualizaciones en los 8 años que llevaba colgado en Youtube.

Como se que desaparecerá les dejo una copia por aqui.

Si Kary Mullis estuviese con vida no podrían haber utilizado su invento para entre comillas “inventarse” esta Tragipandemia. No los hubiera dejado. Sus palabras les atronarían y perseguirían por todas las redes sociales que aunque controladas también por el poder aun nos permiten cierta sensación de libertad.

Se preguntarán vds porque no oímos que otros científicos se quejen amargamente de que gracias a este tipo de pruebas moleculares rápidas podemos meter la pata hasta el corvejón que decía mi abuela. Y se quejan, como la Catedrática de análisis clínicos ya jubilada de la universidad de Murcia María José Martínez pero sus lamentos no llegan a los platós de televisión.

Por ejemplo leía esta semana pasada un hilo del doctor Thomas Binder @Thomas_Binder médico cardiólogo e internista que escribió su tesis sobre inmunologia y virologia en 1984 y que cuenta con 32 años de experiencia tratando pacientes. Decía así:

En 2007, el New York Times explicó muy bien cómo una prueba PCR sin sentido científico había creado una epidemia falsa de tos ferina en 2006. ¿Nos explicarán algún día que en 2020 la pandemia de corona falsa se creó exactamente de la misma manera?

El desastre Coronavirus en pocas palabras:

Una prueba inespecífica no validada se usa de forma incorrecta para identificar a los afectados por un virus en particular y, lo que es peor, para designar a los que han muerto a causa de ese virus.

Para ser precisos: son las pruebas sin sentido las que crean un desastre increíble. Es la fe de muchos en una prueba sin sentido pseudocientífica.

Creer en la ciencia es creer, no ciencia.

¡La prueba es la enfermedad, no el virus!

Durante toda mi vida nunca hemos analizado con un test ningun virus del resfriado, excepto cuando se necesitaba una terapia específica.

Luego vino el aprendiz de brujo Christian Drosten director del instituto de virología hospital de la caridad en Berlín con su prueba de la nada y puso todo al revés.

¡Aquí se va a armar la gorda!”

Este doctor se refería a la pseudo epidemia causada en un hospital donde casi a 1,000 trabajadores de la salud en el hospital de Lebanon en New Hampshire se les realizó una prueba preliminar PCR y se les suspendió el trabajo hasta que obtuvieron sus resultados; A 142 personas, incluido el Dr. Herndon que levantó la liebre sobre un supuesto brote de tosferina, se les dijo que parecían tener la enfermedad; 1,445 trabajadores de la salud terminaron tomando antibióticos y 4,524 trabajadores de la salud en el hospital, o el 72 por ciento de todos los trabajadores de la salud allí, fueron inmunizados contra la tos ferina en cuestión de días. Las camas de los hospitales implicados en este supuesto brote fueron retiradas del uso habitual, incluidas algunas en cuidados intensivos. Y todo por realizar pruebas PCR a todo el que tosiera o pasará por allí. ¿Les suena de algo esto?

En el artículo del New York Times podemos leer textualmente:

Decir que el episodio fue disruptivo fue un eufemismo, dijo la Dra. Elizabeth Talbot, epidemióloga estatal adjunta del Departamento de Salud y Servicios Humanos de New Hampshire.

“No te puedes imaginar”, dijo el Dr. Talbot. “Tuve la sensación en ese momento de que esto nos dio una sombra de lo que podría ser durante una epidemia de gripe pandémica“.

Sin embargo, dicen los epidemiólogos, uno de los aspectos más preocupantes de la pseudo epidemia es que todas las decisiones parecían muy sensatas en ese momento.

La Dra. Katrina Kretsinger, epidemióloga médica de los Centros federales para el Control y la Prevención de Enfermedades, que trabajó en el caso junto con su colega, la Dra. Manisha Patel, no culpa a los médicos de Dartmouth.

“El problema no fue que reaccionaron de forma exagerada o hicieron algo inapropiado”, dijo la Dra. Kretsinger. En cambio, es que a menudo no hay forma de decidir temprano si una epidemia está en curso.

La Dra. Cathy A. Petti, especialista en enfermedades infecciosas de la Universidad de Utah, dijo que la historia tenía una lección clara.

El gran mensaje es que cada laboratorio es vulnerable a tener falsos positivos“, dijo el Dr. Petti. “Ningún resultado de prueba es absoluto y eso es aún más importante con un resultado de prueba basado en PCR

Yo elabore un hilo en marzo de este año mostrando cómo unos científicos chinos habían publicado un paper sobre la alta tasa de falsos positivos titulado “Tasa potencial de falsos positivos entre las ‘personas infectadas asintomáticas’ en contactos cercanos de pacientes con COVID-19

Dicho texto fue fulminado por el gobierno chino apenas haber sido publicado el 5 de marzo de 2020 en varias publicaciones científicas incluida pubmed.

Hoy podemos encontrarlo como retirado por decisión del consejo editorial por las presiones supuestamente sufridas por los lectores.

Parece que no hay cabida para la ciencia disidente y mucho menos en China. El texto desde luego no podia ser más claro…

Sin embargo aqui estamos, en medio de la mayor operación psicológica de inducción al miedo a través de una supuesta epidemia creada en base a los resultados que arroja una prueba, la PCR, que tiene más sombras que luces.

 

Gracias a esta herramienta han logrado que el miedo “al bicho” permanezca en el inconsciente colectivo prolongando algo que no existe…ni hay pandemia de SarsCov2 ni mucho menos existen enfermos asintomáticos, solo existen los rebrotes porque lo dice el test PCR, el kit de caldo para paellas para crear la tragipandemia.

Los medios de comunicación de masas en una connivencia sin fisuras han conseguido inocular el miedo en una población alienada…24 horas de bombardeo continuo de mentiras, embustes y medias verdades.

Nuestros telediarios le tendieron la alfombra roja a las muertes por Covid-19. Con o por…esa era la cuestión.

Y miedo. Mucho miedo. El miedo en los medios. Medios para infundir miedo.

Estamos inmersos en la segunda ola según los medios, afortunadamente los fallecidos hay que buscarlos con lupa.

Exactamente en la misma proporción que se han realizado más pruebas PCR así ha crecido el numero de contagiados.

 

La misma curva…a más test PCR más infectados.

Si analizamos los datos que nos proporciona Nuestro mundo en datos punto org estamos ante una discoteca con luces intermitentes por todos lados…no me deja incrustar el mapa pero pueden verlo aqui.

 

Nuestra amiga, médico, Yane escribió un artículo llamado “Las mentiras diagnósticas del Coronavirus” donde ya en julio mostraba al emperador desnudo pero parece que los políticos, los medios y los rebrotes por realizar PCR iban a empezar a pasearse entre multitudes y nos culparían a los sanos, esta vez los mas jóvenes tendrían la culpa.

Asi que vamos a explicar en que consiste esta prueba PCR con la que han conseguido volver a inocular el miedo sin que hayan apenas fallecidos por este supuesto virus.

¿Cómo funciona la PCR?

Primero la explicación científica reducida que podemos leer en un estupendo articulo publicado en burbuja.info por entcons

Dejaremos en la descripción del podcast como siempre todos los enlaces para que podáis ampliar la información. Este post de burbuja se llama “Manual para dummies ¿por qué el test PCR no sirve en absoluto para detectar el Covid?” y fue publicado ya en abril de este año 2020. Dice así:

Vamos a culturizar un poco al personal. Trataré de simplificar al máximo.

El test PCR funciona de la siguiente manera:

1) tienes una serie de secuencias de oligonucleótidos que puedes comprar en el mercado y en teoría son específicas del 2019-Covid.

Éstas curiosamente cambian dependiendo del país, o sea cada país impone sus secuencias oficiales para detectar 2019-Covid.

Lo que tienen en común para todos los países es que lógicamente esas las secuencias deben existir en el genoma aislado del 2019-Covid .

2) Veamos aquí cuáles son la secuencias oficiales para detectar 2019-Covid en Europa:

Aquí nos muestra 9 secuencias con entre 15 y 20 nucleótidos o letras genicas.

Research Use Only 2019-Novel Coronavirus (2019-nCoV) Real-time RT-PCR Primer and Probe Information

3) Esas secuencias son lo que se llaman “primer forwards” ,”primer reverse” y “probe”. Volveremos a esto más adelante.

4) Al realizar la prueba, se coge una muestra de la traquea de la persona y se mete en un tubo de ensayo. En esa muestra se encuentran multitud de de organismos con DNA .

5) Se procede a calentarlo a 90 grados para que el DNA se divida en dos cadenas en el termociclador.

6) El “forward primer” comprado en el mercado se junta automáticamente al inicio de la cadena, y el “primer reverse” al final de la cadena, pero eso sólo ocurre sí y sólo sí el DNA de la muestra es el del 2019-Covid, en caso contrario los pares no se acoplarían. El acoplado de cada par de cada secuencia es binario, es decir cada par sólo puede acoplarse su complementario.

7) En el proceso se acopla también el “Probe” en mitad de la cadena, con una molécula de fosforecencia.

8) Se inicia el proceso de polimerización en tiempo real, por el que la enzima polimerasa empieza a rellenar los huecos existentes generando nuevo DNA sintético (en verde en gráfico de arriba), hasta que la cadena original de muestra del paciente queda totalmente acoplada con su otra contraparte (compuesta del forward primer, reverse primer, y nuevo DNA proveniente de la polimerización).

9) Así conseguimos un DNA perfecto de 2 cadenas y la liberación de la molécula fosforecente.

10) Se repite el proceso hasta en 40 ciclos (que incluyen calentamiento y enfriamento) que van generando más y más fosforecencia en cuanto más y más sea la cantidad de coincidencias entre los “primers” “forwards” y “probes” (en teoría específicos del 2019-Covid) con el ADN de la muestra del paciente. Eso significará teóricamente que a más intensidad de fosforecencia, para un máximo 40-45 ciclos, más carga viral de Covid debería tener el paciente.

Aquí se explica más detalladamente el proceso entero:
How COVID-19 is diagnosed: bacterium assisted DNA searching – Articles

¿Cuáles son los problemas del test PCR para detectar el Covid?

1- No hay un estándard mundial y cada país usa las secuencias que desea.

2- A mayor nivel de ciclos de temperatura, más positivos, dado que hay más probabilidad ruido y contaminación, y por lo tanto menos fiabilidad.

3- Y en mi opinión el más grave: la polimerización rellena todos los huecos que dejan los primers y probes. Eso quiere decir que si los primers y probes no encajan al 100% en todos sus pares con la cadena de la muestra, la polimerización rellenará esos huecos y, a base de ciclos, dará falsos positivos.

Pero… ¿es que los primers y probes no son específicos del 2019-nCovid? Es como si pregunto si 4 frases al azar sólo pueden existir en un libro. Pues no, pueden aparecer estadísticamente en cualquier otro en una biblioteca de trillones de libros (orden de magnitud del genoma de un virus).

Vosotros mismos podéis comprobar esas secuencias oficiales del 2019-Covid en la base de datos BLAST para el genoma humano:

Probad de hacer vosotros la misma búsqueda en BLAST para las otras secuencias en teoría específicas del 2019-Covid y os daréis cuenta que aparecen todas en el genoma del Homo Sapiens con porcentajes de coincidencia del 70 al 90%.

TCTGGTTACTGCCAGTTGAATCTG

GGGAGCCTTGAATACACCAAAA

¿Qué quiero decir con todo esto?

1) Que el test PCR para detectar el 2019-Covid puede dar los falsos positivos que queramos simplemente aumentando el número de ciclos o comprando en el mercado los primers (gran negocio para los laboratorios vendiendo cosas que nadie mira con microscopio electrónico) que nos dé la gana como hace cada país

2) Que cuando das positivo, lo único que quiere decir con 100% de probabilidad es que eres un Homo Sapiens. No es posible discernir el positivo Homo Sapiens del positivo 2019-Covid. Si das negativo es porque entras dentro del ruido estadístico.

Se liberan más moléculas de colorante fosforescente con cada ciclo de PCR. Esto conduce a un aumento en la señal de fluorescencia proporcional a la cantidad de ampliación sintetizado.

“More dye molecules are released with each PCR cycle. This leads to an increase in the fluorescence signal proportional to the amount of amplicon synthesized. “

3) Los propios test PCR directamente comprados en China pueden estar infectados con 2019-Covid. Así que vigilad qué os meten en la boca para extraer la muestra. (Y ojo porque los propios test del CDC también han sido probados como contaminados, luego leeremos una noticia sobre ello)

Cada país fija su procedimiento para el test PCR seleccionando primers y probes, procedimiento extracción , conservación, número de ciclos. Así pues un país podría fijar un número de ciclos fijo que acabará fijando siempre el mismo porcentaje de positivos y negativos simplemente por ruido estadístico (por ejemplo, cada 100 testeados salen siempre 10 positivos).

Pues resulta que en el Coronavirus Update (Live): 2,014,554 Cases and 127,598 Deaths from COVID-19 Virus Pandemic – Worldometer no te dicen la cifra de testeados, sólo la cifra de positivos (activos y cerrados). ¿Sabéis por qué? Para que no se vea que siempre es el mismo porcentaje de positivos respecto testeados para cada país! Cosa que indicaría que el test no sirve para nada ya que los resultados se fijan de antemano con el procedimiento. El número de positivos simplemente depende de la cantidad de testeados, procedimiento de cada país.

Esta sería la explicación científica…no se si os habéis dado cuenta de que al romper la cadena de ADN y volver a recomponerla con la enzima Polimerasa creamos el doble de cadenas de ADN que teníamos…o sea entramos en una progresión geométrica. La máquina de hacer ADN de la que hablaba el creador de la técnica Kary Mullis.

Esto me recordó a la leyenda del tablero de ajedrez y los granos de trigo.

Cuenta la leyenda que hace mucho tiempo reinaba en cierta parte de la India un rey llamado Sheram.

En una de las batallas en las que participó su ejército perdió a su hijo, y eso le dejó profundamente consternado. Nada de lo que le ofrecían sus súbditos lograba alegrarle.

Un buen día un tal Sissa se presentó en su corte y pidió audiencia. El rey la aceptó y Sissa le presentó un juego que, aseguró, conseguiría divertirle y alegrarle de nuevo: el ajedrez.

Después de explicarle las reglas y entregarle un tablero con sus piezas el rey comenzó a jugar y se sintió maravillado: jugó y jugó y su pena desapareció en gran parte. Sissa lo había conseguido. Sheram, agradecido por tan preciado regalo, le dijo a Sissa que como recompensa pidiera lo que deseara.

– Sissa, quiero recompensarte dignamente por el ingenioso juego que has inventado —dijo el rey.

El sabio contestó con una inclinación.

– Soy bastante rico como para poder cumplir tu deseo más elevado —continuó diciendo el rey—. Di la recompensa que te satisfaga y la recibirás.

Sissa continuó callado.

– No seas tímido —le animó el rey—. Expresa tu deseo. No escatimaré nada para satisfacerlo.

– Grande es tu magnanimidad, soberano. Pero concédeme un corto plazo para meditar la respuesta. Mañana, tras maduras reflexiones, te comunicaré mi petición.

Cuando al día siguiente Sissa se presentó de nuevo ante el trono, dejó maravillado al rey con su petición, sin precedente por su modestia.

– Soberano —dijo Sissa—, manda que me entreguen un grano de trigo por la primera casilla del tablero del ajedrez.

– ¿Un simple grano de trigo? —contestó admirado el rey.

– Sí, soberano. Por la segunda casilla, ordena que me den dos granos; por la tercera, 4; por la cuarta, 8; por la quinta, 16; por la sexta, 32…

– Basta —le interrumpió irritado el rey—. Recibirás el trigo correspondiente a las 64 casillas del tablero de acuerdo con tu deseo: por cada casilla doble cantidad que por la precedente.

Pero has de saber que tu petición es indigna de mi generosidad. Al pedirme tan mísera recompensa, menosprecias, irreverente, mi benevolencia. En verdad que, como sabio que eres, deberías haber dado mayor prueba de respeto ante la bondad de tu soberano. Retírate. Mis servidores te sacarán un saco con el trigo que solicitas.

Sissa sonrió, abandonó la sala y quedó esperando a la puerta del palacio.

Durante la comida, el rey se acordó del inventor del ajedrez y envió a que se enteraran de si habían ya entregado al irreflexivo Sissa su mezquina recompensa.

– Soberano, están cumpliendo tu orden —fue la respuesta—. Los matemáticos de la corte calculan el número de granos que le corresponde.

El rey frunció el ceño. No estaba acostumbrado a que tardaran tanto en cumplir sus órdenes.

Por la noche, al retirarse a descansar, el rey preguntó de nuevo cuánto tiempo hacía que Sissa había abandonado el palacio con su saco de trigo.

– Soberano —le contestaron—, tus matemáticos trabajan sin descanso y esperan terminar los cálculos al amanecer.

– ¿Por qué va tan despacio este asunto? —gritó iracundo el rey—. Que mañana, antes de que me despierte, hayan entregado a Sissa hasta el último grano de trigo. No acostumbro a dar dos veces una misma orden.

Por la mañana comunicaron al rey que el matemático mayor de la corte solicitaba audiencia para presentarle un informe muy importante.

El rey mandó que le hicieran entrar.

– Antes de comenzar tu informe —le dijo Sheram—, quiero saber si se ha entregado por fin a Sissa la mísera recompensa que ha solicitado.

– Precisamente por eso me he atrevido a presentarme tan temprano —contestó el anciano—. Hemos calculado escrupulosamente la cantidad total de granos que desea recibir Sissa. Resulta una cifra tan enorme…

– Sea cual fuere su magnitud —le interrumpió con altivez el rey— mis graneros no empobrecerán. He prometido darle esa recompensa, y por lo tanto, hay que entregársela.

– Soberano, no depende de tu voluntad el cumplir semejante deseo. En todos tus graneros no existe la cantidad de trigo que exige Sissa. Tampoco existe en los graneros de todo el reino. Hasta los graneros del mundo entero son insuficientes. Si deseas entregar sin falta la recompensa prometida, ordena que todos los reinos de la Tierra se conviertan en labrantíos, manda desecar los mares y océanos, ordena fundir el hielo y la nieve que cubren los lejanos desiertos del Norte. Que todo el espacio sea totalmente sembrado de trigo, y ordena que toda la cosecha obtenida en estos campos sea entregada a Sissa. Sólo entonces recibirá su recompensa.

El rey escuchaba lleno de asombro las palabras del anciano sabio.

– Dime cuál es esa cifra tan monstruosa —dijo reflexionando.

– ¡Oh, soberano! Dieciocho trillones cuatrocientos cuarenta y seis mil setecientos cuarenta y cuatro billones setenta y tres mil setecientos nueve millones quinientos cincuenta y un mil seiscientos quince.

La ciencia actual nos trata a todos como verdaderos gilipollas, como ignorantes que no merecen saber nada de esas maravillas científicas y por eso evitan utilizar un lenguaje medianamente inteligible…por eso nosotros vamos a traducirlo para niños.

Por desgracia ya no tenemos con nosotros a Kary Mullis que habría evitado que se utilizase su técnica para crear esta tragipandemia.

“Los científicos están haciendo un daño terrible al mundo en nombre de ayudarlo. No me importa atacar mi propia fraternidad porque me da vergüenza”.

Mullis luego se hizo eco de una de las afirmaciones más controvertidas de Duesberg.

“Los seres humanos están llenos de retrovirus”,”No sabemos si son cientos o miles o cientos de miles. Hace poco comenzamos a buscarlos. Pero nunca han matado a nadie antes. La gente siempre ha sobrevivido a los retrovirus”.

Mullis desafió la sabiduría popular de que los mecanismos del VIH que causan enfermedades son simplemente demasiado “misteriosos” para comprenderlos. “El misterio de ese maldito virus”, dijo en ese momento, “ha sido generado por los $ 2 mil millones al año que gastan en él. Toma cualquier otro virus, gasta $ 2 mil millones y también puede inventar algunos misterios grandiosos al respecto”.

Para el funcionamiento de la PCR se requiere:

– La muestra con el contenido de DNA.

– Los nucleósidos se añaden y serán los que conforman las copias del DNA molde.

– La DNA polimerasa es el enzima que se encarga de realizar la replicación de los fragmentos de DNA.

– Cebadores; los cebadores son pequeñas secuencias de DNA no codificante que son necesarios para iniciar la transcripción del DNA. Estos pequeños polinucleótidos son los que ofrecen la especificidad, fundamentales para poder determinar el fragmento replicado.

Posteriormente se mezclan los componentes descritos y se introducen en el termociclador, donde, por medio de la modificación de la temperatura (un proceso que consta de tres etapas), dará lugar a la desnaturalización de las hebras de DNA. Estas se separan para posteriormente bajar la temperatura y se fijen los cebadores. Por último, se sube de nuevo la temperatura hasta que se inicia la actividad de la polimerasa realizando la replicación.

Este proceso conduce a la duplicación del DNA diana, de forma que al realizar cerca de 40 ciclos obteniéndose cientos de millones de copias.

Ahora vamos a traducir esto para ser entendido por cualquiera. Estas palabras científicas dificultan la comunicación y contribuyen a que muchas personas se sientan inhibidas de preguntar o “lo dejen en manos de los científicos que son los que saben de eso”.

Esto precisamente es aprovechado para imponer una prueba cuestionable como diagnóstico de una enfermedad.

Esto no se puede permitir.

Pasemos sin mas preámbulos a la explicación para Dummies de la PCR. Este es el título que hemos escogido para parafrasear, con cierta gracia, el desconocimiento lógico que usted pueda tener sobre el funcionamiento de la PCR y que al final de este programa le habrá quedado claro. No se preocupe. Allá vamos.

Imaginemos que el virus es una cadena de esas que se ponen al cuello, con sus eslabones.

Estos eslabones, cada uno, van a ser una letra de ADN. El ADN sólo tiene 4 letras (A,C,G,T).

Imaginemos por tanto que los eslabones son de cuatro colores diferentes.

Como muchos sabréis el virus es de ARN pero para esta prueba, se convierte en ADN previamente. La única diferencia entre uno y otro es que la cadena sería doble bicatenaria como una escalera o sencilla monocatenaria como la misma escalera partida por la mitad  pero los colores de los eslabones serían los mismos.

Así que ya tenemos nuestro virus convertido en una cadena de eslabones de ADN. Imaginaos la imagen de una cadena. ¿Ya la tenéis? Esa cadena tiene 30 000 eslabones. Es muy larga.

Para realizar la prueba analizaremos 3 fragmentos de unos 150 eslabones como mucho cada uno, que son los que analiza la prueba.

¿Y por qué 150?

Porque aunque el genoma viral para el SARS-CoV-2 es de aprox. 30 000 eslabones o bases, los test de diagnóstico PCR para virus respiratorios generalmente se dirigen a una pequeña región del genoma viral que suele ser de 80-150 pb o sea de 80 a 150 eslabones cada pedacito. Esto se denomina gen.

Seleccionemos en nuestra cabeza o si queréis en un papel, 3 pedacitos, uno al principio, uno al medio y otro al final de la cadena. Comparados con el total de la cadena serán trozos muy pequeños. Entre los 3 analizaremos 450 eslabones como máximo ( o sea 150 de cada pedazo) de esa larga cadena de 30 000.

¿Ya os dais cuenta de que son pocos verdad? Pero eso es lo que hace la PCR para decir que ese es el bicho.

Ahora imaginemos que esos 3 pedacitos los vamos a multiplicar muchas veces, vamos a hacer lo que se llama una reacción de amplificación. Para hacer esto, necesitamos un aparato del laboratorio que se llama termociclador, pero como nosotros no lo tenemos, vamos a imaginar que tenemos que poner nuestra cadena en una termomix.

Vamos entonces a analizar los 3 pedazos que por su secuencia de eslabones serán del bicho y por tanto identificarían que ese es nuestro bicho o cadena.

Esos 3 pedazos solo se pueden multiplicar si se unen a unos trocitos de eslabones que les vamos a aplicar. Estos son microscópicos y vienen ya diseñados en un kit. Usted solamente debe echar el contenido en la termomix y programar el tiempo que le indica el fabricante.

Los trocitos de 20 eslabones que no hacen mas nada que marcar el inicio y el final de donde se debe formar el molde, son una especie de junta a la que se pega en el inicio y al final del segmento. Esto se llama cebador o primers. Es también una manera de cerciorarse de que el molde se forma en ese pedazo y no en otro. El molde lo ira formando la ADN polimerasa(que es la enzima que le da nombre a esta prueba ) a partir de eslabones sueltos de las 4 letras o colores que también vienen en el kit, o sea va rellenando el agujero que hay entre los cebadores.

Recuerde que usted no ve nada, todo le viene preparado por un fabricante y es microscópico.

Se supone que el cebador tiene una sustancia fluorescente, que emite luz y esa luz es la que va a detectar la termomix para decir, a cierto límite, ya calculado (supongamos que tras 2h y media de cocción por ejemplo que es lo que suele tardar esta parte de la PCR de coronavirus) que ahí está el bicho o cadena, o mas bien, los 3 pedacitos que tras la cocción se han multiplicado.Cada vez que realizamos un ciclo volvemos a partir por la mitad la cadena y donde teníamos 8 trozos obtendremos 16 y así sucesivamente en una progresión geométrica.

Y esto es todo. La PCR por tanto, analiza 3 pedacitos muy pequeños de la cadena que es el bicho y para ello solo tiene que echar un kit o preparado de paella y darle un tiempo de cocción. Eso es lo que determina que alguien tiene esta enfermedad, un kit del fabricante y una termomix que cocina nuestra cadena por un determinado tiempo.

– Ahora bien, os dije que solo hay 4 letras para los eslabones así que lo importante aquí es el orden de los colores de los eslabones. Esto es lo que se denomina secuencia.

La oficialidad dice que esto es muy específico porque ese orden de eslabones que están en nuestros pedacitos escogidos son únicos del bicho. Pero volvemos a lo mismo, no son fragmentos tan grandes, y solo hay 4 letras. ¿Existe la posibilidad de que esas 4 letras en ese orden no se puedan encontrar en otros virus no descubiertos o incluso en partes de nuestro propio ADN? ¿Es mas, es cierto que ese orden de eslabones que utilizan 4 letras sean tan únicas del bicho como dicen? Pues no.

Esos trocitos, que se llaman genes y que son 3 en la PCR que usamos, no son únicos del bicho. Son de la familia del bicho en al menos 2 de los pedacitos y en el tercero al 50%. Así que de los 450 eslabones, 300 serían de cualquier virus de la familia del coronavirus y el que dicen que es específico, a la mitad. Nos quedarían 75 eslabones para decir que es el bicho, eso si, en una determinada secuencia.

Ahora que habéis entendido cómo funciona la prueba, vamos a ponerles nombre a los 3 pedacitos de cadena o genes. Se llaman gen N, gen E y gen RdRp. E codifica una de las proteínas de la envuelta del virus. N codifica la proteína de la nucleocápsida o armazón proteico del virus y RdRp, la enzima que copia el ARN del virus, llamada transcriptasa dependiente de ARN.

En general N y el E son comunes a todos los coronavirus. El RdRp se dice que es especifico pero inicialmente se describió como común  a todos los coronavirus, como consta en informe del 6 de Febrero del Ministerio de Sanidad. Y es que solo una secuencia es única de Sars cov2, o sea unos pocos eslabones (los 75 que calculamos).

Como ejemplo, las tres pruebas de diagnóstico recomendadas por el Centro para el Control de Enfermedades de los EE. UU. (CDC) tienen solo 65, 67 y 72 nucleótidos.

No he podido encontrar las secuencias del gen E, N y rdrp para decir con exactitud de cuantas bases consta así que para ser justos, era mejor calcularlos al máximo tamaño de un gen para estas pruebas. Esto es 150 bases.

Las regiones del genoma vírico que reconocen las sondas de ADN varían según la prueba de que se trate: la diseñada en el Hospital de la Charité (Cristian Dresden) reconoce regiones del gen E que son comunes a todos los coronavirus, así como del gen RdRp, que alberga la enzima responsable de la multiplicación del genoma vírico.

La del Instituto Nacional de Salud de Tailandia sólo tiene en cuenta el gen N, común a todos los coronavirus y otros países aplican otros tipos de cebadores dirigidos a otros genes diana…vamos, de locos.

Las secuencias del supuesto virus que se buscan en este kit de caldo para paella no son secuencias que no estén en nuestro propio ADN tal y como se comentaba en el artículo de burbuja y les invito a que las comprueben por vds mismos en alguna de las bibliotecas del genoma humano que hay disponibles en red como BLAST.

La Doctora María José Martínez Albarracín, Catedrática en Procesos Diagnósticos Clínicos ha publicado en su Facebook que una de esas cadenas genicas que se buscan en el PCR la tenemos en el cromosoma 8 de nuestro propio ADN.

Como explicamos antes estas secuencias específicas a buscar cambian de un pais a otro y de un instituto de salud a otro…ese tan manido consenso de “lo que dice la ciencia” no es ni por asomo cierto. En este documento de la OMS donde se explican todos los protocolos existentes para realizar PCR podemos verlo. (Otro enlace por si “se pierde” el de la OMS)

En dicho documento podemos ver que nunca se debe pasar de los 40 ciclos ya que amplificariamos cualquier cosa que hubiera en la muestra ya que una vez superada la etapa exponencial ya debería ser suficiente.

En este dibujo nos muestran cómo hasta los 20 a 30 ciclos, a partir de la línea verde, no deberíamos de validar la prueba y como el umbral de detección debe ser ajustado para caer dentro de la fase exponencial de PCR.

Siempre debemos estar por debajo de los 40 ciclos ya que por encima vamos a tener muchos falsos positivos.

Imaginense que con esta técnica tenemos que buscar una aguja en un pajar y que dicha técnica nos permite ir haciendo mas grandes los objetos metálicos. Pero nunca vamos a poder ver los objetos, solo veremos una luz fluorescente que es lo que se le añade a la aguja. La aguja va creciendo en cada ciclo y la paja se queda como esta. Lógicamente llegará un momento que la aguja “saltara a la vista”, brillará.

Pero, ¿y qué ocurre con los otros objetos metálicos que hay en el pajar?

Pues lo que ocurre es que también crecen y por lo tanto vamos a poder ver que la moneda, o la arandela o el clavo que estaba en dicho pajar va a brillar tambien si nos pasamos de numero de ciclos. Ese es el error que no queremos.

Pero imaginense que ni tan siquiera pudiéramos estar seguros de que la aguja y la moneda no fuesen lo mismo. Y eso es lo que ocurre en este caso, las supuestas secuencias específicas de este supuesto virus están en nuestro ADN y por ello esta prueba queda totalmente invalidada.

Y lo hemos comprobado.

Hemos buscado en BLAST todas esas secuencias TAAAAAAN específicas que nos dice el CDC (máximo órgano jurisdiccional para controlar una pandemia) de ese supuesto SarsCov2 y las hemos encontrado todas en nuestro ADN.

Todas. Correspondencia del 100% con todo esto. Cromosomas 1,2, 3,6,8,18 y X

También en el cromosoma 9.

No hace falta que les diga que cuando nos hurgan con el hisopo hasta el cerebro para proceder al cepillado de la mucosa respiratoria nos extraen miles y miles de células y por tanto extraen nuestro ADN que contiene entre muchos otros este trozo de cadenas de nucleótidos.

Algunos estudios incluso sugieren que esta toma de muestras en caso de dañar nuestro epitelio nasal, el revestimiento interior de la nariz, podrían facilitar la entrada a bacterias oportunistas eludiendo la barrera hematoencefálica.

La única forma de salir de esta vorágine de nuevos infectados asintomáticos es hacer lo que recomienda el doctor Claus Köhnlein, NO REALIZAR TEST PCR.

Por si desaparece.

Misteriosamente hemos podido comprobar como muchas otras enfermedades contagiosas desaparecian del mapa como podemos ver en el Informe epidemiológico de la semana 21 de la comunidad de Madrid.

 

La tendencia de la gripe es de tener un pico máximo de incidencia cada cuatro años, y este año tocaba que fuera mas fuerte que la temporada 2018-2019 pero sin embargo no ha ocurrido así, todo ha sido Covid-19.

Otras enfermedades como el asma dejaron de molestar a la población. Yo me pregunto si tendría que ver la prácticamente nula fumigación de nuestras ciudades mediante la geoingeniería con la ausencia de episodios asmáticos…eso si, como muy bien dicen ellos estos datos debido a la epidemia de Covid-19 deben tomarse con cautela.

Misteriosamente los otros brotes epidémicos habían desaparecido.

Todo era Covid-19. En abril teníamos tasas de mortalidad en hombres sobre el total de casos notificados de un 12%

¿Los casos notificados son casos confirmados a través de una prueba PCR? Evidentemente no, como podemos ver en este gráfico y en la descripción de casos confirmados por PCR positiva.

La sociedad española no está tan sana como aparenta y nuestros mayores cuentan con factores de riesgo de mas de un 70% en este tipo de enfermedades respiratorias.

Sin embargo aqui estamos, en pleno verano sin prácticamente ningún fallecido por el bicho y disfrutando de llevar un bozal. Y todo ello por los famosos rebrotes obra y milagro de realizar pruebas PCR a gente sana.

Y es que este kit de caldo para paella puede dar positivo a cualquier cosa como una papaya o sangre de cabra como muy bien explicó el presidente de Tanzania, doctor en química y profesor universitario.

Por si desaparece…que a Youtube lo carga el diablo.

Unas muestras congeladas del 2017 pueden dar PCR positivo al Covid-19 tal y como se le escapó al Dr. César Carballo en el programa de Iker Jiménez…preguntense porque si es tan contagioso y tan letal no nos enfermamos hace ya tres años.

En el brillante artículo titulado ¿Fue la prueba COVID-19 diseñada para detectar un virus? escrito por Celia Farber podemos comprobar que esta técnica no fue diseñada para detectar un virus si no para fabricar ADN.

Como bien dice Celia Farber o el doctor Claus Köhnlein los tratamientos inadecuados o sumamente peligrosos como la intubación han causado más muertes que la infección por este supuesto virus.

Como bien nos dicen los propios médicos “las infecciones adquiridas en el nosocomio (hospital, fijense que palabreja utilizan) o relacionadas con la asistencia sanitaria son unos de los grandes retos de seguridad del paciente”.

¿Cuál es la relación entre la propagación de las pruebas y la “propagación” de un nuevo virus? ¿Cómo sabemos lo que estamos experimentando, en comparación con lo que asumimos que estamos experimentando? Un estudio en Austria descubrió que el aumento de las pruebas se correlacionó con, sin sorpresa, un aumento de “casos”.

En una discusión por correo electrónico entre un grupo de científicos, académicos y médicos internacionales, se planteó la pregunta de si el número diario de nuevos casos se seguiría con el número diario de pruebas.

“Sí, lo hacen”, escribió el doctor austriaco Christian Fiala. “Aquí están los datos de Austria. En otras palabras, si quieren aumentar aún más el número de personas ‘infectadas’, también deben aumentar el número de pruebas. Sin embargo, eso es físicamente imposible.

Otro aspecto: durante las primeras semanas la mayoría de las pruebas se realizaron en personas enfermas. Por tanto, el porcentaje de pruebas positivas fue relativamente alto. Pero no hay tantas personas enfermas y con el despliegue general de las pruebas, la gran mayoría de las que se hicieron las pruebas estarán sanas. En consecuencia, el porcentaje de pruebas positivas será bajo y la mayoría serán falsos positivos.

En otras palabras, es imposible continuar con el aumento de resultados positivos de las pruebas “.

“El Dr. Mullis escribió el 7 de mayo de 2013:

“La PCR detecta un segmento muy pequeño del ácido nucleico que forma parte del propio virus. El fragmento específico detectado se determina mediante la elección algo arbitraria de los cebadores de ADN utilizados que se convierten en los extremos del fragmento amplificado.”

Si las cosas se hicieran bien, la “infección” estaría muy lejos de una prueba de PCR positiva.

“Hay que tener una enorme cantidad de cualquier organismo para causar síntomas. Enormes cantidades ”, me dijo el Dr. David Rasnick, bioquímico, desarrollador de proteasas y ex fundador de un laboratorio de EM llamado Viral Forensics. “No comienzas con las pruebas; empiezas por escuchar los pulmones. Soy escéptico de que una prueba PRC sea cierta. Es una gran herramienta de investigación científica. Es una herramienta horrible para la medicina clínica. El 30% de sus células infectadas han muerto antes de que muestre síntomas. En el momento en que muestra los síntomas … las células muertas están generando los síntomas “.

Le pregunté al Dr. Rasnick qué consejo tiene para las personas que quieren hacerse la prueba del COVID-19.

“No lo hagas, digo, cuando la gente me pregunte”, responde. “Ninguna persona sana debería hacerse la prueba. No significa nada, pero puede destruir tu vida, hacerte absolutamente miserable“.

Cada vez que alguien toma un hisopo, una muestra de tejido de su ADN, ingresa en una base de datos del gobierno. Es para rastrearnos”, dice David Rasnick. “No solo buscan el virus. Pon eso en tu artículo “.

Realicé una entrevista de dos horas con David Crowe, investigador canadiense, licenciado en biología y matemáticas, presentador del podcast The Infectious Myth y presidente del grupo de expertos Rethinking AIDS. Desglosó los problemas con la prueba de Corona basada en PCR con gran detalle, revelando un mundo de complejidad inimaginable, así como engaños.

“Lo primero que debe saber es que la prueba no es binaria”, dijo. “De hecho, no creo que existan pruebas para enfermedades infecciosas que sean positivas o negativas“.

La siguiente parte de su explicación es extensa y detallada, pero sigamos adelante:

“Lo que hacen es tomar una especie de continuo y arbitrariamente dicen que este punto es la diferencia entre positivo y negativo”.

“Wow”, dije. “Eso es tan importante. Creo que la gente lo ve como una de dos cosas: positivo o negativo, como una prueba de embarazo. “Lo tienes” o no “.

“La PCR es realmente una técnica de fabricación”, explicó Crowe. “Empiezas con una molécula. Empiezas con una pequeña cantidad de ADN y en cada ciclo la cantidad se duplica, lo que no parece tanto, pero si, si duplicas 30 veces, obtienes aproximadamente mil millones de veces más material del que empezaste. Entonces, como técnica de fabricación, es genial. Lo que hacen es unir una molécula fluorescente al ARN a medida que lo producen. Usted hace brillar una luz en una longitud de onda y obtiene una respuesta, recibe luz enviada de regreso a una longitud de onda diferente. Entonces, miden la cantidad de luz que regresa y ese es su sustituto de la cantidad de ADN que hay. Estoy usando la palabra ADN. Hay un paso en la prueba de RT-PCR que es donde se convierte el ARN en ADN. Entonces, la prueba de PCR en realidad no usa el ARN viral. Está usando ADN pero es como el ARN complementario. Entonces, lógicamente, es lo mismo, pero puede resultar confuso. ¿Por qué de repente estoy hablando de ADN? Básicamente, hay una cierta cantidad de ciclos “.

Aquí es donde se vuelve salvaje.

“En un artículo”, dice Crowe, “encontré 37 ciclos. Si no obtuvo suficiente fluorescencia en 37 ciclos, se lo considera negativo. En otro documento, el límite era 36. Treinta y siete a 40 se consideraron “indeterminados”. Y si llegaba a ese rango, hacía más pruebas. Solo he visto dos artículos que describían cuál era el límite. Por lo tanto, es muy posible que diferentes hospitales, diferentes estados, Canadá versus EE. UU., Italia versus Francia estén usando diferentes estándares de sensibilidad de corte de la prueba Covid. Entonces, si corta a los 20, todos serían negativos. Si cortas un 50, es posible que todos estén positivos “.

Les recomiendo leer completo el artículo de Celia Farber y tambien el aún mas controvertido Las pruebas de PCR COVID19 no tienen sentido científico” redactado por Torsten Engelbrecht y Konstantin Demeter.

Muy probablemente su navegador les indique que se trata de una web no confiable o que incluso podría entrar algun virus en su ordenador al visitar esta web. Nada más lejos de la realidad, simplemente se trata de una web que para Google y otras empresas que controlan la red es un sitio conspiranoico. Lean el articulo y luego extraigan sus conclusiones.

En dicho artículo les mostrarán cómo los fabricantes incluyen en sus prospectos la indicación de que la prueba PCR no sirve para diagnosticar ninguna enfermedad, por supuesto incluyendo el Covid-19. Detectar una pequeña cadena de ADN supuestamente perteneciente a un virus no podrá nunca determinar que estamos enfermos por un supuesto virus.

Test PCR donde sus fabricantes indican que no sirven para diagnosticar. Pueden descargar los prospectos en PDF.

Test PCR VIASURE

Test PCR VITRO

 

Test PCR RealCycler Monotest CORO v.5.2

test PCR GSD NovaPrime

test PCR Canvax

test PCR canvax 1

test PCR canvax 2

test PCR Viasure S gene

Ya lo ven, los fabricantes lo dicen abiertamente. Sus test solo sirven para investigación, no sirven si no van acompañados de un estudio clínico del paciente, su anamnesis, o sea el conjunto de datos que se recogen en la historia clínica de un paciente con un objetivo diagnóstico. También nos dicen que el diagnóstico de una infección no solamente se debe basar en el resultado de la PCR. Aconsejan asimismo que los resultados de la PCR se comprueben mediante métodos alternativos como un cultivo o la propia secuenciación del supuesto virus detectado.

La prueba como pueden ver en este gráfico de la Sociedad Española de Enfermedades infecciosas y microbiología clínica  debería ser lo último a realizar en caso de duda, solo para asegurarnos 100% de que un paciente “que presenta síntomas” no padece este covid19.

Mientras tanto las televisiones, todas, están aterrorizando a la población con fabulaciones, exageraciones y mentiras como esta del número de infectados en un pequeño pueblo de la sierra de Madrid. La Serna del Monte tiene +700 casos por cada 100.000 habitantes. Lógicamente el televidente medio habrá quedado con la boca abierta tras esta abultada cifra de positivos por coronavirus.

Imagen ofrecida por la Secta, perdón, por la Sexta.

Pero da la casualidad que la gente que conoce ese pueblo sabe que no pasa de los 100 habitantes, concretamente en el último censo fueron 77. Así que no hay material humano donde hacer pruebas PCR a +700.

¿Qué quiere decir entonces ese dato de +700 casos por cada 100.000 habitantes?

Pues que si tuvieran 100.000 habitantes tendrían 700 o más positivos, pero traduciendolo mediante una simple regla de tres obtenemos esto:

¿Como le pudieron hacer la PCR a medio habitante de La Serna del Monte? ¿Nos explicará este misterio Iker Jiménez en alguno de sus próximos programas?

Lo único que sabemos es que si tenemos la mala suerte de dar positivo en uno de estos kits de caldo para paella nos van a incomunicar por la cara.

No queremos verlo pero estamos viviendo en una nueva época del auge del nazismo.

¡Luego se preguntarán que porque nadie hizo nada, que porque nadie lo impidió!

Somos todos nosotros los que tenemos que reaccionar e impedir que esta locura vaya a más.

En cualquier momento podemos recibir una carta como esta para exigirnos que nos hagan una PCR.

No lo consientan. No permitan que les realicen una prueba que no sirve para diagnosticar que están enfermos y mucho menos para indicar con absoluta seguridad que es por culpa de un virus. Pueden hacerles la vida imposible y convertirlos en poco menos que unos presos políticos como al italiano que lleva asilado desde el 17 de abril tras haber dado 17 positivos.

Di no a esta nueva normalidad nazi. Pronto irán casa por casa realizando test PCR si es necesario e intentarán vacunar por la fuerza a la población de un supuesto coronavirus para el que nunca han logrado fabricar una vacuna.

Necesitan víctimas sanas…

…como los vampiros chupasangre que son.

Tienen un podcast sobre esto titulado

UTP96 PCR explicada para niños


Otros enlaces

Solo para uso en investigación 2019-Nuevo coronavirus (2019-nCoV) Cebadores y sondas de RT-PCR en tiempo real

https://www.cdc.gov/coronavirus/2019-ncov/lab/rt-pcr-panel-primer-probes.html

Tasa potencial de falsos positivos entre las ‘personas infectadas asintomáticas’ en contactos cercanos de pacientes con COVID-19

https://pubmed.ncbi.nlm.nih.gov/32133832/

Reacción en cadena de la polimerasa

https://es.wikipedia.org/wiki/Reacci%C3%B3n_en_cadena_de_la_polimerasa

Precio de los test PCR

https://www.biosearchtech.com/products/pcr-kits-and-reagents/pathogen-detection/2019-ncov-cdc-probe-and-primer-kit-for-sars-cov-2

Mascarillas y Bacterias

https://www.youtube.com/watch?v=yzJKIVM9AGE&

Mascarillas y Bacterias parte 3

https://www.youtube.com/watch?v=o-jwWjqb4_M&

Muere Kary Mullis, el Nobel que negaba la existencia del virus del sida y del cambio climático

https://elpais.com/elpais/2019/08/13/ciencia/1565717605_558894.html

Tuit de Nozick donde Kari Mullis explica en su libro autobiografico como fue expulsado sin poder exponer nada de la conferencia de Toledo

https://twitter.com/nozick1/status/1282386129371758592

Christian Drosten. Virólogo que empezó a utilizar las pruebas PCR para el sarcov2

https://en.wikipedia.org/wiki/Christian_Drosten

Manual para dummies ¿por qué el test PCR no sirve en absoluto para detectar el Covid?

https://www.burbuja.info/inmobiliaria/threads/manual-para-dummies-por-que-el-test-pcr-no-sirve-en-absoluto-para-detectar-el-covid.1331965/

El Dr. Kary Mullis Premio Nobel de Química 1993 dice que el PCR no detecta carga viral

https://videos.utahgunexchange.com/watch/el-dr-kary-mullis-premio-nobel-de-quimica-1993-dice-que-el-pcr-no-detecta-carga-viral-mp4_JgZTprRTP4HpbS2.html

Sida- La duda. Desinformación y ocultación de los medios (Youtube)

https://www.youtube.com/watch?v=3G4_8Ds2b84&

Sida- La duda. Desinformación y ocultación de los medios

https://videos.utahgunexchange.com/watch/sida-la-duda-desinformacio-n-y-ocultacio-n-de-los-medios-mp4_DWU6fWvxBqg8prP.html

Los laboratorios de los CDC fueron contaminados, retrasando las pruebas de coronavirus, dicen los funcionarios

https://www.nytimes.com/2020/04/18/health/cdc-coronavirus-lab-contamination-testing.html

Hilo sobre test contaminados PCR

https://twitter.com/tecn_preocupado/status/1253330556789460993

Tricare militar accidentalmente le dijo a más de 600,000 personas que habían tenido coronavirus

https://americanmilitarynews.com/2020/07/military-tricare-accidentally-told-600000-people-theyve-had-coronavirus/

Posible causa de la pandemia por coronavirus:

Interferencia inmunológica entre el POLISORBATO 80 de la vacuna antigripal adyuvada y el SARS-CoV-2

https://twitter.com/tecn_preocupado/status/1275825671508496386

Pacientes con COVID = Paciente con Hemoparasitos.

https://twitter.com/EliteMonarca/status/1287012229473337345

Científicos de la Autónoma y UTalca publican artículo en prestigiosa revista Nature Biotechnology

https://www.uautonoma.cl/news/cientificos-de-la-autonoma-y-utalca-publican-articulo-en-prestigiosa-revista-nature-biotechnology/

Dr. Cesar Carballo muestras congeladas 2017 prueba positiva PCR

https://videos.utahgunexchange.com/watch/dr-cesar-carballo-muestras-congeladas-2017-positivo-prueba-pcr-mp4_qhMuf4pdYyHg46d.html

https://d2servp9jyqzxd.cloudfront.net/prd-ugetube-vod-convert-source-1j0ko23jm6jtr/2020/08/NNfbc2d3ZTwl7Mfk5Xwy_01_2953_c9d28aab9e1a80a805f1462f84cb693d.mp4

El Dr Cesar Carballo dice que muestras congeladas del 2017 daban positivo a la prueba PCR

https://twitter.com/LEVANNTE/status/1288763776343461888

¿Fue la prueba COVID-19 destinada a detectar un virus?

https://uncoverdc.com/2020/04/07/was-the-covid-19-test-meant-to-detect-a-virus/

Las pruebas de PCR COVID19 carecen de sentido científico (articulo muy bueno alojado en una página llamada conspiranoica)

https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/

Las mentiras diagnósticas del Coronavirus

https://tecnicopreocupado.com/2020/07/08/las-mentiras-diagnosticas-del-coronavirus/

Ministerio de Sanidad, Consumo y Bienestar Social. Estudio Nacional de sero-Epidemiología de la Infección por SARS-CoV-2 en España (ENE-Covid) Preguntas y respuestas frecuentes (pregunta 5 y 6)

https://www.mscbs.gob.es/ciudadanos/ene-covid/faqs.htm

¿Me va a dar el resultado de la prueba por escrito?

Sí, le daremos el resultado del test rápido de anticuerpos por escrito. Sin embargo, es importante que sepa que este test no permite diagnosticar si usted tiene COVID-19.

Este test no diagnostica la enfermedad. Haber tenido contacto con el coronavirus no significa estar enfermo.

Tampoco nos dice si usted es contagioso o no, es decir, con este resultado no sabemos si usted puede trasmitir o no el virus a otras personas.

Su resultado (positivo o negativo) será útil cuando, en un análisis estadístico posterior, se combine con el de otros participantes para tener datos sobre el grado de contacto de la población española con el virus.

¿El test que me van a hacer es fiable?

EL COVID19 es una enfermedad nueva y estos tests que miden si ha habido contacto previo con el virus se han desarrollado recientemente y por tanto la información de cómo funcionan se acaba de generar y no existen por el momento grandes estudios de validación, como nos gustaría. El test tiene el certificado de la Comunidad Europea. No obstante, antes de iniciar ENE-COVID19 (este estudio), hemos probado esta herramienta para confirmar que funciona bien, es decir, que detecta si están presentes los anticuerpos que demuestran que ha habido un contacto anterior con el virus. Se ha probado en alrededor de 100 personas que ya pasaron la enfermedad y en muestras donadas que se utilizaron para diagnosticar otras enfermedades y se habían obtenido antes de que el coronavirus estuviese aquí. Los resultados obtenidos muestran que el test tiene alta sensibilidad y especificidad (mayores al 80%), es decir detecta bastante bien el contacto con el virus. No obstante, necesitamos más información y por eso en este estudio vamos a recoger otros tipos de muestra para poder comparar, cuando dispongamos de mejores herramientas.

Es importante que tenga en cuenta que medir el contacto con el coronavirus no es suficiente para diagnosticar COVID19 y tampoco nos dice si usted es o no contagioso en este momento.

La fe en la prueba rápida conduce a una epidemia que no era

https://www.nytimes.com/2007/01/22/health/22whoop.html

María José Martínez Catedrática univ Murcia

https://videos.utahgunexchange.com/watch/mari-a-jose-marti-nez-catedra-tica-univ-murcia-pruebas-pcr-mp4_3L3AqYnX2Npnxw4.html

“La OMS ha actuado como instrumento de manipulación mundial” (excelente entrevista a la Dra María José Martínez Catedrática univ Murcia)

“La OMS ha actuado como instrumento de manipulación mundial”

Test PCR detecta exosomas

https://videos.utahgunexchange.com/watch/test-pcr-2-mp4_mnQtYsbOktHc1R6.html

Merienda con Luis de Miguel

https://www.youtube.com/watch?v=v3jBEqwlGZA&

Y en su web se detallan todos los pasos legales administrativos a seguir si nos quieren hacer una prueba y lo que debemos exigir sobre el test en sí mismo.

https://www.scabelum.com/post/__pcr

Jefe de la OMS dice que ciertos rebrotes de COVID-19 se deben a “jóvenes que bajan la guardia”

https://lta.reuters.com/articulo/salud-coronavirus-oms-idLTAKCN24V2YK-OUSLT?taid=5f22feff31ce9a000122a602&utm_campaign=trueAnthem%3A+Trending+Content&utm_medium=trueAnthem&utm_source=twitter

Asistentes a discotecas valencianas con brotes de covid-19 se niegan a hacerse test

https://www.elconfidencial.com/espana/comunidad-valenciana/2020-07-30/asistentes-discotecas-con-brotes-se-niegan-a-hacerse-test_2701031/

COVID-19 sufre modificaciones genéticas a lo largo del tiempo que es necesario seguir. Aunque hay cebadores de la técnica de PCR que pueden no detectar la presencia de COVID-19, como el protocolo requiere la identificación de objetivos múltiples de COVID-19, se reducen las probabilidades de obtener resultados de identificación de la presencia de COVID-19 falsamente negativos.

https://www.iacs.es/covid-19-sufre-modificaciones-geneticas-a-lo-largo-del-tiempo-que-es-necesario-seguir-aunque-hay-cebadores-de-la-tecnica-de-pcr-que-pueden-no-detectar-la-presencia-de-covid-19-como-el-protocolo-requ/

Presidente de Tanzania denuncia graves irregularidades en gestión del Coronavirus.

https://www.youtube.com/watch?v=6mQMXKrL58k&&feature=emb_logo

https://d2servp9jyqzxd.cloudfront.net/prd-ugetube-vod-convert-source-1j0ko23jm6jtr/2020/05/X5hlRrrtfzKYpWExwCic_09_2217_22b2d820a38dd9bc09dc50b407b16a78.mp4

Test PCR donde sus fabricantes indican que no sirven para diagnosticar

Test PCR VIASURE

https://open.lbry.com/@tecnico.preocupado:7/IU-NCO212enes0420-rev.01:e

Test PCR VITRO

https://open.lbry.com/@tecnico.preocupado:7/MAD-003941M_22720_2138_MAD-003941M-FT-ES-Completa-2020-07-16:d

Test PCR RealCycler Monotest CORO v.5.2

https://open.lbry.com/@tecnico.preocupado:7/Manual-deinstruccionesCOROv.5.2:d

test PCR GSD NovaPrime

https://open.lbry.com/pcov603x_6-sprachig_2020-07-14:9

test PCR Canvax

https://open.lbry.com/@tecnico.preocupado:7/qMAXSen™-Coronavirus-SARS-CoV-2-RT-qPCR-detection-Kit-E-and-RdRp-gene-assays:a

test PCR canvax 1

https://open.lbry.com/@tecnico.preocupado:7/qMAXSen™-Coronavirus-SARS-CoV-2-RT-qPCR-Detection-Kit-N-and-RNAse-P-genes-based-Assay:5

test PCR canvax 2

https://open.lbry.com/@tecnico.preocupado:7/qMAXSen™-Coronavirus-SARS-CoV-2-RT-qPCR-Detection-Kit-RdRp-gene-assays:d

test PCR Viasure S gene

https://open.lbry.com/@tecnico.preocupado:7/VS-NCO124enes0420-rev-02:4

Un hombre permanece aislado en Italia tras 17 test positivos de Covid-19

https://www.abc.es/sociedad/abci-hombre-permanece-aislado-italia-tras-17-test-positivos-covid-19-202007231415_noticia.html

Toma de muestras (explicación)

https://www.youtube.com/watch?v=o6cb6uNyGSU&

Daños en el interior de la nariz da ‘vía libre’ a las bacterias para llegar al cerebro

https://www.elconfidencial.com/tecnologia/ciencia/2020-03-18/dano-nariz-bacterias-cerebro-enfermedad_2504280/

La leyenda del tablero de ajedrez y los granos de trigo

https://matematicascercanas.com/2014/03/10/la-leyenda-del-tablero-de-ajedrez-y-los-granos-de-trigo/

Las Vacunas contra el coronavirus han fallado durante décadas

https://cienciaysaludnatural.com/las-vacunas-contra-el-coronavirus-han-fallado-durante-decadas/

Programa 46 con Maria Jort (Maria desilumínate) donde hablamos sobre la realidad oculta de la pandemia

https://www.ivoox.com/programa-46-maria-jort-maria-desiluminate-donde-audios-mp3_rf_50920792_1.html

DEL PANICO Y LA NEGLIGENCIA A LA INVERSION EN SEGURIDAD SANITARIA. FINANCIACION PARA LA PREPARACION  ANTE UNA PANDEMIA A NIVEL NACIONAL (2017/2018)

https://desmontandoababylon.com/2020/05/03/del-panico-y-la-negligencia-a-la-inversion-en-seguridad-sanitaria-preparacion-ante-futuras-pandemias-a-nivel-nacional/

Event 201, simulacro de coronavirus La parte dedicada al tratamiento en los medios

https://desiluminate.org/2020/04/20/event-201-simulacro-de-coronavirus-la-parte-dedicada-al-tratamiento-en-los-medios/

Memorando del Banco Mundial: Desde el Pánico y la Negligencia a la inversión en seguridad sanitaria. (Blog Maria Desiluminate)

https://desiluminate.org/2020/06/04/memorando-del-banco-mundial-desde-el-panico-y-la-negligencia-a-la-inversion-en-seguridad-sanitaria/

Orden de 16 de julio de 1996 por la que se declara a doña Josefa Martínez Albarracín aprobada en el proceso para la adquisición de la condición de Catedrática en los Cuerpos de Profesores de Enseñanza Secundaria, convocado por Orden de 5 de diciembre de 1994.

https://www.boe.es/diario_boe/txt.php?id=BOE-A-1996-20655

Links y papers de información pruebas pcr:

https://www.sciencemag.org/news/2020/02/united-states-badly-bungled-coronavirus-testing-things-may-soon-improve

https://www.fda.gov/media/134922/download

https://www.sciencedirect.com/topics/immunology-and-microbiology/virus-nucleocapsid

https://edition.cnn.com/2020/03/21/politics/us-coronavirus-tests-invs/index.html

https://www.cdc.gov/media/releases/2020/t0212-cdc-telebriefing-transcript.html

https://www.the-scientist.com/news-opinion/how-sars-cov-2-tests-work-and-whats-next-in-covid-19-diagnostics-67210

https://www.who.int/emergencies/diseases/novel-coronavirus-2019/technical-guidance/laboratory-guidance

https://www.npr.org/sections/health-shots/2020/03/26/822084429/in-defense-of-coronavirus-testing-strategy-administration-cited-retracted-study

https://www.ncbi.nlm.nih.gov/pubmed/15094372

https://www.dailymail.co.uk/news/article-8171223/Britains-young-coronavirus-victims-Teen-18-youngest-casualty-RSPCA-worker-26-dies.html

https://www.spectator.co.uk/article/how-to-understand-and-report-figures-for-covid-19-deaths-

https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/877302/guidance-for-doctors-completing-medical-certificates-of-cause-of-death-covid-19.pdf

https://www.ons.gov.uk/peoplepopulationandcommunity/birthsdeathsandmarriages/deaths/bulletins/deathsregisteredweeklyinenglandandwalesprovisional/weekending20march2020

https://www.hiddensyria.com/wp-content/uploads/2020/04/COVID-19-Survellance-Bulletin-02.04.20.pdf

https://www.cdc.gov/nchs/data/nvss/vsrg/vsrg03-508.pdf

https://www.cdc.gov/nchs/data/nvss/coronavirus/Alert-1-Guidance-for-Certifying-COVID-19-Deaths.pdf

https://swprs.org/rki-relativiert-corona-todesfaelle/

https://www.faz.net/aktuell/gesellschaft/gesundheit/coronavirus/neue-corona-symptome-entdeckt-virologe-hendrik-streeck-zum-virus-16681450.html?printPagedArticle=true

https://www.thecollegefix.com/stanford-epidemiologist-warns-that-coronavirus-crackdown-is-based-on-bad-data/

Los kits de GENOMICA para la detección del Coronavirus Covid-19, listos para comercializarse.

https://www.youtube.com/watch?v=u-7pjV0gjao&

Porcentaje del total de pruebas de COVID-19 que dieron positivo

https://ourworldindata.org/grapher/covid-19-positive-rate-bar


Legal disclaimer

 

 

El MAL en mayúsculas y otros elefantes de habitación

Sentirse mal por dentro es algo que muchas veces no podemos describir con palabras. Saber que el MAL con mayúsculas está detrás de prácticamente todo lo que nos pasa en este mundo de locos, en esta tragipandemia de bozal y avieso confinamiento puede causar a veces un profundo dolor en el pecho. Y en eso estamos.

In memorian. No os olvidamos.

Así que os voy a perturbar con muchas cosas que os harán pensar y os crearán pesadillas difíciles de olvidar. Avisados estáis.

Las rosas blancas sobre el pebetero…sobre el pebetero ritual encima del sombrero de copa. En Galicia fueron ofrecidas 619 rosas blancas por las víctimas gallegas.

Un 6 de julio, rosas blancas que simbolizan la pureza infantil, concretamente la pureza infantil femenina…en el santoral de Santa María Goretti

Santa María Goretti, virgen y mártir, que en una época infantil dura, donde se vio en la necesidad de ayudar a su madre en las labores de la casa, distinguiéndose ya por su piedad, cuando no contaba más que doce años murió en defensa de su castidad a causa de las heridas que le produjo con un punzón un joven que intentaba violarla cuando estaba sola en su casa, cercana a la localidad de Nettuno, en el Lacio, de Italia.

Fue desde luego un funeral muy masónico. En la plaza de armas del palacio real de Madrid situado exactamente a 666 millas náuticas del muy famoso hospital Juan XXIII de Bérgamo sitio cumbre del coronavirus italiano como muy bien nos mostró PeterHouse.

Y es que nada queda al azar cuando hablamos de la gente que trabaja para el MAL.

Las rosas blancas simbolizan a la perfección las víctimas inocentes como muy bien utiliza la pintora Alexandra Wasilewska, posiblemente una niña abusada en su infancia y hoy dia una de las pintoras favoritas de esa élite psicópata, pederasta satánica que nos mal gobierna desde las sombras.

Yo llevo en esto de preocuparme en las redes sociales desde el 2011. Ya saben que empece en un medio de comunicación supuestamente independiente llamado Canal Zero.

Lo abandone al ver cosas que no me gustaban. Una de ellas ver cómo se hacían algunos programas junto a masones o rotarios. La entrevista a Federico Mayor Zaragoza por un medio recién creado en 2013 o al presidente del Club Rotario España Bernardo Rabassa Asenjo no me dejaron ver el bosque.

Desde Canal Zero me pidieron grabar el primer episodio sobre Alcasser. Un guión que fue rectificado más de 15 veces hasta dar con la versión definitiva que no nos causará problemas legales. Dentro de Canal Zero contábamos con varios abogados “amigos”, alguno de ellos tertuliano de la casa.

Entonces no lo entendía, no lo vi. Era bastante más inocente que en la actualidad.

Uno de los colaboradores que no aparecían en los créditos pero que sí estaban presentes en el núcleo del programa y que llegue a conocer en persona fue a Rafa Navarro.

Hoy día es una de las casi 2000 cuentas que tengo bloqueadas pero como ven en la fotografía anterior nos seguiamos mutuamente.

 

La cuestión es que Rafa públicamente en su cuenta de Twitter presumia de su buena amistad con Oscar de Alfonso, Gran maestro de la Logia de España.

Y es que, Oscar, parece que nuestros caminos están destinados a cruzarse.

La pregunta es porque estaría la masonería interesada en sacar la basura acumulada en las cloacas del Estado. ¿Por qué impulsaría un medio de comunicación alternativo como Canal Zero? Un medio que sería un referente dentro de todo lo que pasó durante el movimiento 15M.

No voy a contestar ninguna de esas preguntas pero voy a seguir contándoles cosas que el #periodismo_que_calla suele dejar también en el tintero.

¿Se acuerdan de Juanri, ese estudiante de magisterio que visitó cientos de colegios privados (alguno concertado también) entrevistando a alumnos y profesores y que terminó siendo juzgado como pederasta?

Desde la prensa nos hicieron creer que era un depredador solitario. Lo primero que se hizo fue eliminar de un plumazo todas sus cuentas sociales, por ejemplo su canal en Youtube con cientos de videos bien elaborados y editados.

El llevaba desde 2011 con un blog que presumía de tener más de 100.000 visitas diarias, medio millón en alguno de los picos, elaborando una media de un video nuevo cada tres días.

Organizar, visitar, grabar y editar los videos en más de cien colegios de España y de fuera de España nunca pudo ser cosa de un solo delincuente…pero como digo nos lo vendieron asi y nunca más se supo de él.

El bloguero solitario acepto los siete años que pidió la fiscalía para el. Y los medios aún con condena firme seguían mostrando sus iniciales o llamándolo Juanri.

Como recogían los medios de comunicación allá por 2018 “Juanri”, que se enfrentaba a 20 años de cárcel –según había pedido la Fiscalía–, ha visto reducida su condena a siete años por el delito de abuso continuado de abusos a un menor de siete años, y a un año y tres meses por la producción de pornografía infantil. Por la tenencia de material pedófilo, sin embargo, tan solo tendrá que pagar una multa. El ‘depredador sexual’ pagó 80.000 euros de la responsabilidad civil por esto último y la sala lo ha tenido en cuenta como atenuante.

Fue la misma fiscalía la que rebajó la petición de pena. Esa fiscalía que me mantiene a mi en un proceso judicial por supuestamente hablar de supuestos pederastas…del poder…claro.

Pero no es mi intención hablar de este gusano, un simple catalogador de niños, uno de los que si Dios quiere alguien destapará en toda su magnitud.

Tan solo quiero que se fijen en la simbología que de forma sibilina introduce en algunas de sus composiciones como este pentagrama invertido formado por niños a los que les dijo que posaran así.

Aún hubo alguna persona como este cura colombiano que defendió a este pederasta intentado decir que su detención estaba basada en infundios perpetrados por ese supuesto partido de izquierda que es Podemos.

Podemos tuvo su oportunidad pero rápidamente recordó quien le había colocado allí y para que por mucho que la gente se lo recordase.

Tuvo su momento, y lo aprovechó pero no para contar la verdad si no, al parecer, para ocultarla.

Nadie quería ver el enorme elefante en la habitación.

 

El horroroso arte de la pintora polaca nos muestra el perfil típico de alguien bien vestido con buenos zapatos, chaleco, corbata y gafas de marca.

Aunque algunos lo pintaran muy enfadado como el de Alexandra Wasilewska nadie veía al elefante.

Todas las obras de esta pintora son terribles y hablan sobre el abuso ritual de menores.

Este cuadro de las niñas torturadas corriendo en un bosque es uno de los más famosos pero tiene centenares de ellos a cual más horrible.

Incluso alguno donde se ve como la policía incluso contribuye supuestamente a este abuso.

Donde hay niños siempre habrá escoria pederasta o pedofila. No olviden esto.

Si algo les gusta a los niños son los juguetes.

El poder, la popularidad, la fama, la gloria…esa fina línea roja atravesada por cuernos.

Y uno de los objetivos del PODER es promover la pedofilia.

Este texto era parte de un hilo publicado en burbuja.info titulado ¡SORPRESA! The New York Times pide incrementar los derechos de los PEDÓFILOS


Desde hace años hay una campaña muy agresiva en Internet para normalizar la pedofilia. En la Wikipedia, Menéame y otras webs que acaparan el tráfico participan de manera regular y organizada pedófilos que intentan promover su agenda de manera sutil.

Uno de los mantras que promueve este lobby es que la pedofilia no es lo mismo que la pederastia, de forma que no hay nada de malo en ser pedófilo mientras se mantenga la inclinación “en privado”. Mediante este subterfugio dialéctico pretenden blanquear el término pédofilo y normalizar su apestosa inclinación. Lo grave es que, gracias a la propaganda viral de sus ideas en la Red, están consiguiendo convencer a gente de buena fe que no acierta ver sus intenciones.

Otro mantra que promueve el lobby es que la pedofilia no tiene nada que ver con la homosexualidad, lo cual es una aberración histórica y médica. Como demostraré al final citando dos diccionarios, la pederastia siempre se ha asociado a la homosexualidad.

Esos repugnantes círculos han llegado a inventarse el término de pedofilofobia para designar a los que critican a los pedófilos:
pedofilofobia | INDIGNADO

Están utilizando básicamente las mismas tácticas que se usaron para despenalizar la homosexualidad. Dentro de la jerga que promueven está la famosa caza de brujas para referirse a la persecución de la pornografía infantil en Internet. Según el argumentario del lobby pedófilo, que tiene predicamento incluso en ambientes académicos, sería bueno legalizar la pornografía infantil porque reduciría los abusos sexuales de los pederastas (he aquí el fruto de esa maligna distinción entre pedófilo y pederasta):
Legalizing Child Pornography reduces child sex abuse crimes (Scientific study by Dr. Milton Diamond, U. Hawaii) | Human Stupidity: Irrationality, Self Deception

Si acudimos a cualquier diccionario no manipulado, veremos que la pederastia es la atracción sexual por los niños, sin entrar a distinguir si el pervertido se queda en los pensamientos o si, además, pasa la acción. Es de cajón que si una persona tiene esa inclinación, o cualquier otra inclinación sexual, va a intentar satisfacerla en cuanto pueda. Lo único que le refrena es la penalización que podría sufrir por parte de la sociedad. Por ello persiguen que la sociedad deje de ver su inclinación como algo intrínsecamente desordenado y perverso.

Veamos esta definición tomada de un diccionario médico de 1823:

PEDERASTIA.- s.f. Paederastía, de paidos, muchacho, y de érao, amar. Es el amor ilícito entre los hombres, vicio infame reprobado por la moral, la naturaleza y la razón.

Diccionario de medicina y cirugía o Biblioteca manual médico-quirúrgica – Antonio Ballano – Google Libros

Aquí vemos que el concepto de pederastia siempre ha sido el mismo que el de pedofilia; la distinción que se intenta hacer entre pensamiento y acción es artificial y persigue fines nada inocentes. No hay ninguna otra inclinación sexual con la que maneje esa sutil distinción entre pensamiento y acción. Un zóofilo es el que se siente atraído por los animales y probablemente copula con ellos. No existe la palabra zoorasta para designar exclusivamente al que copula con los animales, ni zóofilo designa sólo al que se queda en los pensamientos.

Quizá la única diferencia de matiz es que pederastia implica necesariamente a un varón homosexual, mientras que pedofilia es un término médico más reciente que también podría incluir a las mujeres.

Veamos otra definición tomada de un diccionario jurídico de 1838:

PEDERASTIA.– Generalmente se toma esta palabra griega por el concúbito entre personas de un mismo sexo ó en vaso indebido, pero la ley no entiende por pederastía ó sodomía sino el concúbito de hombre con hombre. En el Fuero Juzgo se ordena que los pederastas sean castrados y entregados al obispo para que los ponga en cárceles separadas donde hagan penitencia, como también que si son casados se apliquen sus bienes a sus hijos legítimos y puedan casarse sus mujeres con quienes quisieren. En el Fuero Real se añade á la castradura que esta se haga públicamente, que al tercer día sean colgados de las piernas los sodomitas hasta que mueran y que nunca se les quite del patíbulo. Las Partidas prescriben simplemente la pena capital declarando que el forzado y el menor de catorce años no han de haber pena alguna. La Recopilación impone la muerte de quema y la confiscación de todos los bienes aunque el delito no se haya consumado, con tal que haya habido actos muy próximos á su consumación y no haya quedado por los reos el consumarle. La práctica había establecido últimamente dar primero garrote á los reos para que no muriesen desesperados en las llamas, quemarlos luego en una hoguera y esparcir sus cenizas, pero ya se ha mitigado mucho la severidad de las penas prescritas contra este y demás delitos de incontinencia y ya no se instruye á la tierna juventud con espantosos suplicios de la existencia de una horrible disolución que debiera siempre ignorar.

Diccionario razonado de legislacion civil, penal, comercial y forense, ó sea … – Joaquín Escriche – Google Libros

Es una pena que toda esta sabia legislación que enumera este diccionario se haya derogado. Cuando se derogan estas leyes diseñadas para proteger a los más débiles, los depredadores dejan ser penalizados por la sociedad y se acaban publicando artículos como el del New York Times. El siguiente paso ya podéis imaginar cuál es, porque ya hemos vivido todo el proceso de normalización de la homosexualidad.


Volvamos a Juanri y a la comunidad valenciana. Juan Rivera Pascual vecino del pueblo de Massarrojos alias “Juanri” que estudiaba segundo curso de Magisterio de primaria y que está en libertad se vanagloriaba de ganar hasta 8.000 euros mensuales gracias a las reseñas en su blog de escuelas privadas y concertadas de medio mundo. Si el nombre de tu colegio no aparecía allí no tenías cache. Con 10 meses “de trabajo” habría podido pagar la multa.

Su antiguo blog registrado a su nombre en Holanda (cuna de la mayor cantidad de pornografia infantil alojada en servidores del planeta) ha pasado a mejor vida, ya no podemos obtener ningún dato, todo es privado.

Todo lo relacionado con este conseguidor de niños ha ido desapareciendo paulatinamente de la red, como esta entrevista titulada Detenido un profesor acusado de violar a decenas de niños en Colombia y España | Radio HRN

Y aqui es cuando os voy a poner un video del ya desaparecido blog de Juanri donde nos hablaba junto a dos psicólogos de la Fundación Daniela sobre la transexulidad de los menores. Obviamente este video ya no lo podreis encontrar en ningún sitio, se ha convertido en un video proscrito.

 

La Fundación Daniela es una de esas fundaciones que se llevan todo tipo de premios y son promocionadas desde el poder.

 

Supuestamente en la parte contraria hay gente que opina que la homosexualidad se puede curar..incluso escriben libros sobre ello.

Libros que son rechazados de forma encendida por la oficialidad.

Cuando alguien con el apellido Cohen nos vende la moto con un tema tan polémico lo primero que hago yo es desconfiar del mensaje y del mensajero.

Este señor ha escrito un cuento para niños también basado en esas ideas.

 

Odio. Generar odio es parte de lo que necesitan para alimentarse.

¿Desaparecerá un video que llevaba tranquilamente desde 2010 en Youtube?

Cuando alguien con el apellido Levy nos vende la moto con un tema tan polémico lo primero que hago yo es desconfiar del mensaje y del mensajero.

Necesitan de dos polos para poder crear una energía que utilizar. Una energía sutil que muchos de nosotros estamos proporcionándoles sin ser sabedores de ello.

Esa energía está simbólicamente reflejada en absurdos gestos como los de Bob Esponja tocado con un sombrero masónico con ojo incluido.

Esa energía está simbólicamente reflejada en discursos de nuevos héroes que no dudan en insertar un Baphomet justo en el minuto y 33 segundos de su discurso.

El famoso “Solve et Coagula” que tan buenos rendimientos lleva dandoles desde el principio de los tiempos.

En estos momentos estamos siendo utilizados como catalizadores de un gran cambio, un gran RESET que necesita de mucha energía para ser llevado a cabo.

Me acabo de escribir un amigo en España: “Acaba de llegarme la noticia via Presidencia del Colegio de Notarios y Registradores de la Propiedad, en España NUEVO CONFINAMIENTO a partir del 5 de septiembre. Esto estalla. La gente se va a tirar a la calle.” Daniel Estulin

Necesitan cabrearnos de tal modo que lo que venga sea aceptable.

Un ejemplo es esta imagen que nos venden como de canibalismo cuando en realidad se trata de una performance llevaba a cabo en el año 2000 por el artista chino Zhu Yu titulada Eating People. Allí el artista se preguntaba  ¿La ley exige matar a un segundo hijo? Pero, si ingieres al “hijo neonato” ¿se penalizará?

Otros artistas han utilizado fetos como si fueran comida.

Helados, pasteles, chupa chups…

Y comida, pizzas concretamente. Nadie mira así a una pizza, ¿verdad?

Hay mucho tomate aqui. Otro día prometo abrir el bote.

Nada es lo que parece, pero si queremos saber donde puede haber un pedófilo tan solo debemos estar cerca de los niños o del poder. Donde hay poder hay pedofilos…y no lo digo yo.

Ya sabéis que yo llevo luchando en Twitter para que se haga algo en contra de la pedofilia que corre a sus anchas sin que el famoso #algoritmo_Twitter parezca servir para nada. Pero las redes sociales sirven para lo que sirven…y las cuentas que la denuncian suelen terminar desapareciendo…de las tres que aparecen aqui solo quedo yo.

Como bien dice Coto Matamoros desde hace ya muchos años…

…y como dijo recientemente en el programa Cake Night Show presentado por Kako Senante…

¡Qué sí, que los que están en el poder son satanicos!

Nos lo dicen ellos mismos. No se ocultan. Medio en serio medio en broma. Y como siempre en la comunidad valenciana.

Como bien nos ha contado Pedro Bustamante, toda esta caterva de gente que pertenece a organizaciones secretas o discretas en el fondo están buscando la llegada del Androginarcado.

Por eso los niños del futuro deben ser lo más andróginos posibles. Y por eso hay tanto interés desde el poder en facilitarles todo tipo de facilidades en que sean lo que ellos quieran ser.

Ya saben que el primer mandamiento del satanismo es que lo primero eres tu…aunque te hagas daño.

Hay cuentas en las redes sociales trabajando todos los días para influir en nuestros hijos, para acercarlos a esta nueva modernidad amoral.

Curiosamente con una abeja como fotografía principal. Ya saben la afición de la masonería por ese símbolo que les representa como un grupo de abejitas que trabajan juntas por un cometido.

Yo fui una de las cuentas que a través de denuncias conseguimos que esta cuenta fuera cerrada. He omitido algunos desnudos suyos o de otras personas que esta cuenta publicó en abierto en Twitter.

Amate a ti mismo, ama a quien te dé la gana. Un bonito mensaje si no fuera porque esconde el peor veneno.

No os olvidamos. Se que algún día daremos con los nombres de vuestros asesinos.


Legal disclaimer

Las mentiras diagnósticas del Coronavirus

Desde hace tiempo quiero explicaros una observación personal. A estas alturas creo que estaréis familiarizados con conceptos como la PCR y los test de anticuerpos para detectar al bicho y que queda claro que son insuficientes y erróneos partiendo de la técnica teórica.

La PCR es una reacción de amplificación del ADN o ARN que en el caso de los virus, solo se aplicaría a “trozos” del mismo, que son los llamados genes, por lo que nunca podrías asegurar que dichos fragmentos no se encuentran en otros virus no descubiertos e incluso se buscan los genes familiares, que mas que diferenciar, nos podrían hasta confundir.

Kary Mullis (Descubridor de la técnica PCR).

Pero por que se empeñan en usar esta técnica que su propio descubridor sostenía que utilizada en los llamados “test de carga viral” era un oxímoron (del griego: ὀξύμωρον, oxymoron, en latín contradictio in terminis), dentro de las figuras literarias en retórica, era una figura lógica que consiste en usar dos conceptos de significado opuesto en una sola expresión, que generaba un tercer concepto, ejemplo: “hielo abrazador” o sea, ¿cómo se puede amplificar lo que debes contabilizar?

¿No será porque quedaría al descubierto la mentira?

Si quieres saber que estás frente a un virus determinado lo correcto sería secuenciarlo y de esta manera, asegurar con un 99,99% de posibilidad que efectivamente es ese y no otro. Tendrías la lista de todas sus bases (C, G, A, U para un virus ARN).

Y es que secuenciar un virus es algo complejo cuando en principio debes aislarlo y reconocerlo, asegurarte de que es ese, como sucedió con nuestro “entrañable” SarsCov2, que saltó de los murciélagos al hombre por “gracia divina” y conveniente “interés”, siendo identificado en una semana. Pero una vez lo has identificado, la cosa cambia y veréis por que.

La secuenciación de ADN es una técnica ampliamente usada en casos de establecer paternidad, criminalística, ancestros, etc. Al menos esto es teóricamente pero tened cuidado con el sitio en donde os lo practicais no vaya a ser que os pase como a este chico que utilizo My Heritage y que luego de pagar 65€, reconoce el timo. Mi consejo es que no suministreis vuestro ADN para ninguna base de datos pero es vuestra elección.
Ya sabéis , aquello del libre albedrío…

https://www.elespanol.com/ciencia/investigacion/20190604/test-geneticos-conocer-origenes-italiano-primo-ucrania/402210557_0.html

Ahora bien, me asaltó la duda de por que no se puede hacer lo mismo con los virus, si es la técnica correcta. Siempre se me dijo que era muy costoso y complicado. Supongo que como el resto asimile esta explicación, pero observando que se hace en estos procesos de paternidad y pensando como una “conspiranóica”, todo cambia. El refrán “piensa mal y acertarás” tendría que ser el principio que deberíamos llevar por bandera en este mundo gobernado por el mentiroso mayor.

Empecé a consultar los precios del mercado de un secuenciador, si era posible que fuese un problema que fueran virus de ARN y al no ser ADN fuese todo mas complicado pero NO.

La historia de los secuenciadores es larga. Me consta su presencia en universidades y hospitales públicos. ¿Se podrá por tanto utilizar?

Vamos a tratar de resolver la compatibilidad de la técnica actual con el numero de bases nitrogenadas del virus SarsCov2. Según se plantea en el mundillo científico, el ARN del coronavirus actual consta de 30.000 bases nitrogenadas. Se trata de un virus grande comparado con el virus VIH que tiene 10 000.

https://www.ideal.es/opinion/como-se-hace-test-covid19-realiza-datos-aporta-20200323145813-nt.html

Según la mismísima wikipedia, fuente por excelencia de la VO así como otras como pubmed, la secuenciación actual abarcaría de 300-1000 nucleótidos o bases de longitud. Así que 30 000 bases del coronavirus o incluso las 10.000 del VIH serían demasiado grandes de completar. No obstante, se podría obtener fragmentos mayores que los “genes”de la actual PCR aunque ya os adelanto que este no es el único método, solo es el convencional.

Si hace una década secuenciar el ADN costaba unos 300.000 dólares -equivalentes a 283.000 euros-, en la actualidad el coste se sitúa en torno a los 1.000 -940 euros-. Por tanto, el avance de las máquinas que están siendo desarrolladas por Illumina sería totalmente disruptivo, reduciendo el precio de la secuenciación a la décima parte del coste actual. 

Según las declaraciones del ejecutivo de la compañía Francis DeSouza recogidas por Gizmodo, estas secuenciadoras lowcost llegarán dentro de diez años, no solamente abaratando el proceso sino acelerándolo considerablemente, ya que prometen una rapidez seis veces superior a la actual. 

Los sistemas NovaSeq 5000 y 6000 tendrán un precio de 850.000 dólares y 985.000 dólares respectivamente, siendo mucho más económicos en relación al precio de las muestras que otras máquinas empleadas en la actualidad, como los sistemas HiSeq X Five o HiSeq X Ten de la compañía.

Esto os puede parecer una burrada pero a nivel inversión de laboratorio de salud y mas en una enfermedad como esta, que abarca un espectro de enfermos tan amplio, tendría toda la justificación del mundo y abarataría los precios actuales al establecer competencia. Todo esto sin contar que existen otros fabricantes como los chinos, inmensamente mas económicos y no por ello menos serios.

Aquí os pongo el enlace a Ebay de un secuenciador de Illumina, la empresa fabricante mas potente, pero mucho mas barato.

https://m.spanish.alibaba.com/amp/p-detail/62021978826.html?spm=a2706.amp_promotionhttps://m.spanish.alibaba.com/amp/p-detail/62021978826.html?spm=a2706.amp_promotion

La secuenciación del ARN, que por razones técnicas es más sencilla de llevar a cabo que la del ADN, se desarrolló con anterioridad a esta última.

La de ARN data de la era previa al ADN recombinante. Se trató de la secuencia del primer gen completo y del genoma completo del Bacteriófago MS2, identificado y publicado por Walter Fiers y colaboradores de la Universidad de Gante.

Pero repito, disponemos ya de estos secuenciadores en hospitales y universidades. Por tanto, esta inversión estaría infrautilizada, al margen de las necesidades actuales.

Aquí el hospital 12 de Octubre de Madrid.


https://www.actasanitaria.com/el-hospital-12-de-octubre-incorpora-la-secuenciacion-masiva-la-practica-clinica-del-centro/

Aquí el Clinic de Barcelona…


https://www.clinicbarcelona.org/servicio/area-operativa-del-laboratorio-core-de-biologia-molecular/asistencia

Os pongo la captura de los servicios de la empresa Cabimet en Andalucia.

https://www.cabimer.es/web3/unidades-apoyo/genomica/secuenciacion-masiva-ion-torrent-e-illuminahttps://www.cabimer.es/web3/unidades-apoyo/genomica/secuenciacion-masiva-ion-torrent-e-illumina

Lo que quiero es que os deis cuenta de que esta tecnología NGS sería capaz de secuenciar masivamente hasta 400 pares de bases (pb). Al coronavirus solo le hacen falta 30.000 bases y al VIH menos. Y todo en 3 h.

Observemos esta noticia de actualidad correspondiente a Enero de este año 2020:

“Roche e Illumina se asocian para ampliar el acceso de los pacientes a los test genómicos”.

https://www.roche.es/es_es/comunicacion/actualidad/2020/enero/roche-e-illumina-se-asocian-para-ampliar-el-acceso-de-los-pacien.html

Roche es el líder mundial en diagnóstico in vitro y diagnóstico histológico del cáncer, y se sitúa a la vanguardia en el control de la diabetes.

En esta noticia tenemos la unión de la empresa”reina” de los laboratorios (Roche) con Illumina, la fabricante de secuenciadores de nueva generación (NGS) para dominar el sistema de diagnóstico y tratamiento “personalizado” de los pacientes en esta terrible patología.

Aunque la tecnología NGS que permite realizar la secuenciación masiva ha ido mejorando progresivamente y ahora se anuncia que es posible secuenciar el genoma completo de un humano al precio de 1.000$, no hay descanso en el intento de conseguir  secuenciar más rápida y económicamente.

Hace ya años que se habla de una de las posibles tecn